Phytophthora infestans (Montagne) de Bary (ATCC® MYA-4127)

Strain Designations: T30-4  /  Product Format: frozen

Strain Designations T30-4
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Plant pathogen.
Genome sequencing strain (Broad Institute, USA).
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTACCACACCTAAAAACTTTCCACGTGAACCGTTTCAACCCAATAGTTGGGGGTCTTACTTGGCGGCGGCTGCTGGCTTTATTGCTGGCGGCTACTGCTGGGCGAGCCCTATCAAAAGGCGAGCGTTTGGACTTCGGTCTGAGCTAGTAGCTTTTTTATTTTAAACCCTTTACTTAATACTGATTATACTGTGGGGACGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACAACAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGAGATGCCAGATGTGAAGTGTCTTGCGGTTGGTTTTCGGACCGACTGCGAGTCCTTTTAAATGTACTAAACTGTACTTCTCTTTGCTCCAAAAGTGGTGGCATTGCTGGTTGTGGACGCTGCTATTGTAGCGAGTTGGCGACCGGTTTGTCTGCTGCGGCGTTAATGGAGAAATGCTCGATTCGTGGTATGGTTGGCTTCGGCTGAACAATGCGCTTATTGGGTGATTTTCCTGCTGTGGCGTGATGGACTGGTGAACCATGGCTCTTTAGCTTGGCATTTGAATCGGCTTTGCTGTTGCGAAGTAGAGTGGCGGCTTCGGCTGCCGAGGGTCGATCCATTTGGGAAATGTTGTGTACTTCGGTATGCATCTCAATTGGACCTGATATCAGGCAAGATTACCCGCTGA


D1D2 region of the 28S ribosomal RNA gene

CATCTCAATTGGACCTGATATCAGGCAAGATTACCCGCTGAACTTAAGCATATTAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGATCAGTGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTCGTGCGTACGATCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGCGGCTTTTTTGGCTGCGCTCGGCGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCCGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGTTTTTGAGTGGGCCTGTGTCTCTGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGTGGGTTTTAACTTGTTG

Name of Depositor F Govers
Special Collection NSF - Mycology
Chain of Custody
ATCC <-- F Govers
Isolation
Potato (Solanun tuberosum), Netherlands.
Geographical Isolation Generated in Laboratory of Phytopathology
Cross References

Complete Genome (GenBank) : AATU00000000 Phytophthora infestans T30-4, whole genome shotgun sequencing project

References

Haas BJ, et al. Genome sequence and analysis of the Irish potato famine pathogen Phytophthora infestans. Nature 461:393-398, 2009. PubMed: 19741609