Trichophyton interdigitale (ATCC® MYA-3108)

Strain Designations: H6  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Trichophyton rubrum
Strain Designations H6
Biosafety Level 2

Biosafety  classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments Genome sequencing strain (Broad Institute, USA)
The strain was re-identified by DNA barcode sequencing
Morphology On Emmons’ modification of Sabouraud’s medium at 25°C after 6 days, mycelium white, velutinous to cottony, dense. Reverse buff. Hyphae hyaline. Conidia hyaline, ellipsoidal to broadly ellipsoidal, smooth, 4-7.5 X 2.5-3 µm.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTAACGCGCAGGCCGGAGGCTGGCCCCCCACGATAGGGCCAAACGTCCGTCAGGGGTGAGCAGATGTGCGCCGGCCGTACCGCCCCATTCTTGTCTACATTACTCGGTTGCCTCGGCGGGCCGCGCTCTCCCAGGAGAGCCGTTCGGCGAGCCTCTCTTTAGTGGCTAAACGCTGGACCGCGCCCGCCGGAGGACAGACGCAAAAAAATTCTTTCAGAAGAGCTGTCAGTCTGAGCGTTAGCAAGCAAAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAGCCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCGCCCCCGTCTTTGGGGGTGCGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTCCTAGGCGAATGGGCAACAAACCAGCGCCTCCAGGACCGGCCGCCCTGGCCTCAAAATCTGTTTTATACTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCTCCCCCGGGGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGGTGCGGCCGCCGTCTAAGTTCCTTGGAACAGGACGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGGCGGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTCGGGGGCGGGGTTCAGCGGGTGCTCGTCGCCCGTGTATTCCTCGTCTCCCGGGCCAGCATCAGTTTCGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGTCTCTCGGGACGTCTTATAGCCGGGGGTGCAATGCGGCCCGTCGGGACTGAGGAACGCGCTCCGGCTCGGATGCTGGCGTAATGGCCGTAAGCGG

Morphology On Emmons’ modification of Sabouraud’s medium at 25°C after 6 days, mycelium white, velutinous to cottony, dense. Reverse buff. Hyphae hyaline. Conidia hyaline, ellipsoidal to broadly ellipsoidal, smooth, 4-7.5 X 2.5-3 µm.
Name of Depositor N Martinez Rossi, C Maffei
Special Collection NSF - Mycology
Chain of Custody
C Maffei
N Martinez Rossi
Isolation
Skin and nails - human, Brazil
Geographical Isolation Univ. of Sao Paulo
References

Fachin A L, et al. Effect of sub-MICs of antimycotics on expression of intracellular esterase of Trichophyton rubrum. Med. Mycol. 39: 129-133, 2000.

Ferreira-Nozawa M S, et al. The dermatophyte Trichophyton rubrum secretes and edta-sensitive alkaline phosphatase on high-phosphate medium. Braz. J Microbiol. 34: 161-164, 2003.

Fachin A L, et al. In vitro susceptibility of Trichophyton rubrum isolates to griseofulvin and tioconazole. Induction and isolation of a resistant mutant to both antimycotic drugs.. Mycopathologia 135: 141-143, 1996.

Pereira M, et al. The gene that determines resistance to tioconazole and to acridine derivatives in Aspergillus nidulans may have a corresponding gene in Trichophyton rubrum. Mycopathologia 143: 71-75, 1998.

Mendes A, Martinez-Rossi N M. 18S-rDNA sequencing, enzyme patterns and morphological characterization of Trichophyton isolates. Braz. J Microbiol. 32: 179-186, 2001.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation