Trichophyton interdigitale (ATCC® MYA-3108)

Strain Designations: H6  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Trichophyton rubrum
Strain Designations H6
Biosafety Level 2
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments Genome sequencing strain (Broad Institute, USA)
The strain was re-identified by DNA barcode sequencing
Morphology On Emmons’ modification of Sabouraud’s medium at 25°C after 6 days, mycelium white, velutinous to cottony, dense. Reverse buff. Hyphae hyaline. Conidia hyaline, ellipsoidal to broadly ellipsoidal, smooth, 4-7.5 X 2.5-3 µm.
Medium Medium 28: Emmons' modification of Sabouraud's agar
Medium 200: YM agar or YM broth
Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTAACGCGCAGGCCGGAGGCTGGCCCCCCACGATAGGGCCAAACGTCCGTCAGGGGTGAGCAGATGTGCGCCGGCCGTACCGCCCCATTCTTGTCTACATTACTCGGTTGCCTCGGCGGGCCGCGCTCTCCCAGGAGAGCCGTTCGGCGAGCCTCTCTTTAGTGGCTAAACGCTGGACCGCGCCCGCCGGAGGACAGACGCAAAAAAATTCTTTCAGAAGAGCTGTCAGTCTGAGCGTTAGCAAGCAAAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAGCCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCGCCCCCGTCTTTGGGGGTGCGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTCCTAGGCGAATGGGCAACAAACCAGCGCCTCCAGGACCGGCCGCCCTGGCCTCAAAATCTGTTTTATACTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCTCCCCCGGGGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGGTGCGGCCGCCGTCTAAGTTCCTTGGAACAGGACGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGGCGGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTCGGGGGCGGGGTTCAGCGGGTGCTCGTCGCCCGTGTATTCCTCGTCTCCCGGGCCAGCATCAGTTTCGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGTCTCTCGGGACGTCTTATAGCCGGGGGTGCAATGCGGCCCGTCGGGACTGAGGAACGCGCTCCGGCTCGGATGCTGGCGTAATGGCCGTAAGCGG

Morphology On Emmons’ modification of Sabouraud’s medium at 25°C after 6 days, mycelium white, velutinous to cottony, dense. Reverse buff. Hyphae hyaline. Conidia hyaline, ellipsoidal to broadly ellipsoidal, smooth, 4-7.5 X 2.5-3 µm.
Name of Depositor N Martinez Rossi, C Maffei
Special Collection NSF - Mycology
Chain of Custody
C Maffei
N Martinez Rossi
Isolation
Skin and nails - human, Brazil
Geographical Isolation Univ. of Sao Paulo
References

Fachin A L, et al. Effect of sub-MICs of antimycotics on expression of intracellular esterase of Trichophyton rubrum. Med. Mycol. 39: 129-133, 2000.

Ferreira-Nozawa M S, et al. The dermatophyte Trichophyton rubrum secretes and edta-sensitive alkaline phosphatase on high-phosphate medium. Braz. J Microbiol. 34: 161-164, 2003.

Fachin A L, et al. In vitro susceptibility of Trichophyton rubrum isolates to griseofulvin and tioconazole. Induction and isolation of a resistant mutant to both antimycotic drugs.. Mycopathologia 135: 141-143, 1996.

Pereira M, et al. The gene that determines resistance to tioconazole and to acridine derivatives in Aspergillus nidulans may have a corresponding gene in Trichophyton rubrum. Mycopathologia 143: 71-75, 1998.

Mendes A, Martinez-Rossi N M. 18S-rDNA sequencing, enzyme patterns and morphological characterization of Trichophyton isolates. Braz. J Microbiol. 32: 179-186, 2001.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation