Komagataella phaffii Kurtzman (ATCC® 76273)

Strain Designations: NRRL Y-11430 [21-1, CBS 7435]  /  Product Format: freeze-dried

Deposited As Komagataella pastoris
Strain Designations NRRL Y-11430 [21-1, CBS 7435]
Application
Produces alcohol oxidase.
Produces single-cell protein SCP.
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (The Institute of Molecular Biotechnology, Graz University of Technology, Austria.
Mitochondrial genome sequenced (The Institute of Molecular Biotechnology, Graz University of Technology, Austria).
Morphology On YM medium at 25°C after 8 days, colonies creamy white, butyrous, dull, smooth, margin entire. Cells hyaline, globose to subglobose, smooth, 3-7 X 3-6 µm. Pseudohyphae not observed.
Medium Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGTCCACCTTTGAAGTATTGACGTGGTTGGGAGAGGCAATGTGCACAAGTCGCCTGGAACGGCCGCCAAAGAGGGTGATAGCCCCGTAGCACGGTCAACCTTCCCAGCCGACAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAAGGTGGTAGGGTCCATCAAAGACTAAATATCAGCGAGAGACCGATAGCAAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAACAGTGCGTGAAATTGGGGGGAGGGAAGGCAAGGCCACGACAAGTGGTCCTGCG

Morphology On YM medium at 25°C after 8 days, colonies creamy white, butyrous, dull, smooth, margin entire. Cells hyaline, globose to subglobose, smooth, 3-7 X 3-6 µm. Pseudohyphae not observed.
Name of Depositor NRRL
Chain of Custody
ATCC <-- NRRL <-- Phillips Petroleum Co. 21-1
References

Wegner EH. Biochemical conversions by yeast fermentation at high cell densities. US Patent 4,617,274 dated Oct 14 1986

Hopkins TR. Alcohol oxidase from Pichia-type yeasts. US Patent 4,619,898 dated Oct 28 1986

Kuberl A, et al. High-quality genome sequence of Pichia pastoris CBS7435. J. Biotechnol. 20;154(4): 312-320,2011. PubMed: 21575661

Kurtzman CP. Biotechnological strains of Komagataella (Pichia) pastoris are Komagataella phaffii as determined from multigene sequence analysis. J. Ind. Microbiol. Biotechnol. 36: 1435-1438, 2009. PubMed: 19760441