Cunninghamella elegans (ATCC® 36112)

Strain Designations: PA-1  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Cunninghamella elegans Lendner, teleomorph
Strain Designations PA-1
Application
Degrades 1-nitropyrene
Degrades acenaphthene
Degrades acridine
Degrades dibenzothiophene
Degrades fluoranthene
Degrades petroleum crude oil
Degrades phenanthrene
Metabolizes 1-fluoronaphthalene
Metabolizes 9,10-dimethylanthracene
Metabolizes 9-hydroxymethylanthracene
Metabolizes 9-methylanthracene
Metabolizes fluorene
Oxidizes dibenzothiophene
Oxidizes isoquinoline
Oxidizes quinoline
Produces 3'-hydroxywarfarin
Produces acridine trans-1,2-dihydrodiols
Produces trans-dihydrodiols
Transforms 1-nitrobenzo[e]pyrene
Transforms benz[a]anthracene
Transforms brompheniramine
Transforms chlorpheniramine
Transforms pheniramine
Degrades phenanthrene to trans-dihydrodiols
Degrades acridine to acridine trans-l,2-dihydrodiol and 2-hydroxyacridine
Detoxification of 1-nitropyrene
Oxidizes dibenzothiophene to dibenzothiophene sulphoxide and dibenzothiophene sulphone
Transformation of benz[a]anthracene to trans-dihydrodiols
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (Concordia University, Canada).
Morphology After 10 days colonies spreading rapidly, at first white, later with dark spots of conidia, becoming gray, conidiophores erect, with verticillate or solitary branches; vesicles subglobose to pyriform, verrucose or smooth, conidia globose. 7-11 µm, or ovoid to ellipsoidal, 6-10 x 9-13 µm, smooth, verruculose, or shortly echinulate, hyaline, or with granular contents, brownish in mass.
Medium ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTACTTATTCGGTCATTGGTTTTTATTCAAAAACCTTTGGCTTTAAATCATCCACAGTGTGGGAAATGTCTTCTAACGCTTGTGCCTGGTTCAGTCTAGTGCTGCCACTTGAGTTTACTCTTGGGTCAAGGGACCTTTGGGTAGTTTGTTCATTCGTGAGCAACCTCTTGTAACGGGGATAAGATTAATTTTATTATACTAAATTTTACTGAACTGATAGACCATAAATCTATGGTTGTTTTTTATTATAAACAAAAAAACAACTTTCAGCAATGGATCTCTCGGCTTTCGTATCGATGAAGAACGCAGCAAATCGCGATATGTAATGTGATCTGCCTATAGTGAATCATCAAATCTTTGAACGCATCTTGCACCTTATGGTATTCCATAAGGTACGTCTGTTTCAGTACCACTAGTAAATCTCCCCTCCACCTTGGTGGTTTAAAAGGAAGAGATAAATTATTACTGGTTCTGGTGATTCTTGATTTATTAAGAATTACTCTCGACCTAAATATAAGGCTCGACTTTTTTATTAGATCTCGCATCTGGTAAAACCTAGTCGGCTTTAATAGGATTTATTTCTTATTAGGTTTATAGCCATCATTTTACTTTTAAATCTTGGCCTGAAATCAGATGGGACTACCCGCTGAACTTAAG


D1D2 region of the 26S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAAATAACAATGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAAAGCTCAAAGTTGGAACCTGGTGGGCATAGCTCACCCGGATTGTAAACTAAAGTTTTTGAGTCGTTTAGTCAGCCAGGTAAATAAGTCCTCTGGAAAGGGGCGACATAGAGGGTGAAATCCCCGTCTTTGGCCTGAGTTTTGGTTAGGCGTTTGGCTTGGAAACGAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAAATGGGAGGTAAATCTCTCCTAAAGCTAAATATTGACGAAAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGAAAAGAGGGTCAAAAAGTACGTGAAATTGCTGAAAGGGAACCGTATGAAATCAGACCTACTGGTAGGTAATCAATCTTTCCCTTGGGAAGGATGCACTTGCCTGCTATGTATGCCAGCGACATTTTGGTTGGGAGGAAAAAAATAGAAGGAATGTAGCCTAGGCTTCGGTTTAGGTGTTATAGACTTTTATAAAATACTCTCGGCTGGAATGAGGAACGCAGCAAACCGTAAGGCGAAGATTCTAGTCGCTTGGGGGGAATAATTAGAGAATTTCTGCTTCGGGTGGTGCTTTGATTATTACTTTCAACTCGGTTGGAGTTCTTTTAATTTGCTTAGGTTGTTGGCTTAATGATTTTATATGAC

Morphology After 10 days colonies spreading rapidly, at first white, later with dark spots of conidia, becoming gray, conidiophores erect, with verticillate or solitary branches; vesicles subglobose to pyriform, verrucose or smooth, conidia globose. 7-11 µm, or ovoid to ellipsoidal, 6-10 x 9-13 µm, smooth, verruculose, or shortly echinulate, hyaline, or with granular contents, brownish in mass.
Name of Depositor JJ Perry
Isolation
Estuarine mud
Cross References

Nucleotide (GenBank) : Y17298 nucleotide and amino acid sequences of mRNA for enolase

Nucleotide (GenBank) : AF195659 Cunninghamella elegans NADPH-dependent cytochrome P450

Nucleotide (GenBank) : Y17297 Cunninghamella elegans mRNA for 6-phosphogluconate dehydrogenase.

References

Perry JJ, Cerniglia CE. Effect of substrate on the fatty acid composition of hydrocarbon-utilizing filamentous fungi. J. Bacteriol. 118: 844-847, 1974. PubMed: 4829928

Cerniglia CE, et al. Fungal metabolism and detoxification of the nitropolycyclic aromatic hydrocarbon 1-nitropyrene. Appl. Environ. Microbiol. 50: 649-655, 1985. PubMed: 3907498

Crawford DL, Gupta RK. Oxidation of dibenzothiophene by Cunninghamella elegans. Curr. Microbiol. 21: 229-231, 1990.

Cerniglia CE, et al. Effects of a fluoro substituent on the fungal metabolism of 1- fluoronaphthalene. Appl. Environ. Microbiol. 48: 294-300, 1984. PubMed: 6486779

Cerniglia CE, et al. Stereoselective fungal metabolism of methylated anthracenes. Appl. Environ. Microbiol. 56: 661-668, 1990. PubMed: 2317041

Pothuluri JV, et al. Fungal metabolism and detoxification of fluoranthene. Appl. Environ. Microbiol. 58: 937-941, 1992. PubMed: 1575497

Pothuluri JV, et al. Fungal metabolism of acenaphthene by Cunninghamella elegans. Appl. Environ. Microbiol. 58: 3654-3659, 1992. PubMed: 1482186

Pothuluri JV, et al. Biotransformation of fluorene by the fungus Cunninghamella elegans. Appl. Environ. Microbiol. 59: 1977-1980, 1993. PubMed: 8328814

Sutherland JB, et al. Enantiomeric composition of the trans-dihydrodiols produced from phenanthrene by fungi. Appl. Environ. Microbiol. 59: 2145-2149, 1993.

Cerniglia CE, et al. Metabolism of benz[a]anthracene by the filamentous fungus Cunninghamella elegans. Appl. Environ. Microbiol. 60: 3931-3938, 1994. PubMed: 7993083

Wong YW, Davis PJ. Microbial models of mammalian metabolism: production of 3'- hydroxywarfarin, a new metabolite of warfarin using Cunninghamella elegans. J. Pharm. Sci. 80: 305-308, 1991. PubMed: 1865328

Schlenk D, et al. P450 catalysed S-oxidation of dibenzothiophene by Cunninghamella elegans. Xenobiotica 24: 1077-1083, 1994. PubMed: 7701849

Hansen EB Jr., et al. Fungal transformations of antihistamines: metabolism of brompheniramine, chlorpheniramine, and pheniramine to N-oxide and N- demethylated metabolites by the fungus Cunninghamella elegans. Xenobiotica 25: 1081-1092, 1995. PubMed: 8578764

Pothuluri JV, et al. Biotransformation of 1-nitrobenzo[e]pyrene by the fungus Cunninghamella elegans. J. Ind. Microbiol. Biotechnol. 22: 52-57, 1999.

Wang RF, et al. Cloning, sequencing, and expression of the gene encoding enolase from Cunninghamella elegans. Mycol. Res. 104: 175-179, 2000.

Cerniglia CE, Perry JJ. Crude oil degradation by microorganisms isolated from the marine environment. Z. Allg. Mikrobiol. 13: 299-306, 1973. PubMed: 4797813

Sutherland JB, et al. Identification of metabolites produced from acridine by Cunninghamella elegans. Mycologia 86: 117-120, 1994.

Sutherland JB, et al. N-Oxidation of quinoline and isoquinoline by Cunninghamella elegans. Exp. Mycol. 18: 271-274, 1994.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation