Mortierella alpina Peyronel (ATCC® 32222_TT)

Strain Designations: M136 [ATCC 32222; CBS 528.72]  /  Product Format: test tube

Permits and Restrictions

View Permits

Strain Designations M136 [ATCC 32222; CBS 528.72]
Application
Produces arachidonic acid
Produces eicosapentaenoic acid
Produces polyunsaturated fatty acids
Biosafety Level 1
Product Format test tube
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Preceptrol® no
Genome Sequenced Strain

Yes

Mating Type Mates with ATCC 32221
Comments
Hetero-azeotropic distillation
Genome sequencing strain (Nankai University, China)
Medium Medium 307: Cornmeal agar
Growth Conditions Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TCCGCTTATTGATATGCTTAAGTTCAGCGGGTACTCCTACCTGATTTGAGGTCAACTTTAAGAACATTGTTCGCCTAGACGCTCTCTTCTTATCGATAACGTTCCAATACGCTCAGTATAAAAAAGATTAGCCGCAGTTGGTAAAACCTAAAACGACCGTACTTGCATTATACCTCAAGCACGCAGAGAAACCTCTCTTTGGAAAAAAAACATCCAATGAAAAGGCCAGCAATTTCAAGTTAACTCCAAAAGTATCACTCACTACCAAACAGAATGTTTGAGAAGGAAATGACGCTCAAACAGGCATGCCCCCTGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGGAATTCTGCAATTCACTTACGTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTTAATATTTTAAAATTTCCAGTTACGAAAATTCTTGTTTTTGACAAAAATTTAATGAATAGTAAAATTGTTTGTGTTTGTTACCTCTGGGCCCCGATTGCTCGAATGCCCAAAGAAAAAGTTGCAAAGATATGAAAACTCCACAGTGTGTTGTATTGAAACGGTTTTAATTGTCCTATAACAAAAGCAAGAAATCTCTCACCGTTTGGAATAGCAAGAAAGAAACTTACAAGCCTAGCAAGACCGCGCACTTAAGCGCAGGCCCGGCTGGACTCTCCATCTCTTGTCTTCTTGCCCAGTAAAAGCTCTCATGCTCTGCCAAAACAAAAAAATCCATTTTCAAAATTATTAAATTTCTTTAATGATCCTTCCGCAGGTTCACCTAC

Name of Depositor EG Kuhlman
Chain of Custody
ATCC <-- EG Kuhlman <-- CS Hodges
Isolation Soil, North Carolina
Cross References

Nucleotide (GenBank) : Y18553 Mortierella alpina ole1 gene for stearoyl-CoA desaturase.

Nucleotide (GenBank) : Y18554 Mortierella alpina ole2 gene for stearoyl-CoA desaturase.

Complete Genome (GenBank) : ADAG00000000 Mortierella alpina ATCC 32222, whole genome shotgun sequencing project

References

Bajpai PK, et al. Production of arachidonic acid by Mortierella alpina ATCC 32222. J. Ind. Microbiol. 8: 179-186, 1991. PubMed: 1367901

Bajpai P, et al. Eicosapentaenoic acid (EPA) formation: comparative studies with Mortierella strains and production by Mortierella elongata. Mycol. Res. 95: 1294-1298, 1991.

Kuhlman EG. Zygospore formation in Mortierella alpina and m. spinosa. Mycologia 67: 678-681, 1975.

Jang HD, et al. Polyunsaturated fatty acid production with Mortierella alpina by solid substrate fermentation. Bot. Bull. Acad. Sinica 41: 41-48, 2000.

Tough AJ, et al. Hetero-azeotropic distillation: combining fungal dehydration and lipid extraction. J. Biosci. Bioeng. 90: 37-42, 2000.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation