Mortierella alpina Peyronel (ATCC® 32222_TT)

Strain Designations: M136 [ATCC 32222; CBS 528.72]  /  Product Format: test tube

Permits and Restrictions

View Permits

Strain Designations M136 [ATCC 32222; CBS 528.72]
Application
Produces arachidonic acid
Produces eicosapentaenoic acid
Produces polyunsaturated fatty acids
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format test tube
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Preceptrol® no
Genome Sequenced Strain

Yes

Mating Type Mates with ATCC 32221
Comments
Hetero-azeotropic distillation
Genome sequencing strain (Nankai University, China)
Medium ATCC® Medium 307: Cornmeal agar
Growth Conditions Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTGAACCTGCGGAAGGATCATTCATAATCAAAGTGTTTTTATGGCACTTTTAAAAAAATCCATATCCACCTTGTGTGCAATGTCATCTCACTGGAGGCCGGCGGCTGTAAAAAGCCCGTTTGGTCACCTTTGGGATTTATATCTACTCAGAACTTTAGTGATTTTGTCTGAAAAATATTATGAATAACTTAATTCAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCTCTCTGGTATTCCGGAGAGCATGCTTGTTTGAGTATCAGTAAACACCTCAACTCCCTTTTTCTTTTTTGAAATGAGGGAGCTGGACTTGAGTGATCCCAACACTTTTCTCACTGAAAAGTGGCGGGTCACTTGAAATGCAGGTGCAGCTGGACTTTTCTCTGAGCTATAAGCATATCTATTTAGTCTGCCTAAAAAACAGATTATTACCTTTGCTGCAGCTAACATAAAGGAGATGAGTTCTTGTGCTGACTGATGCAGGATTCACAGAGACAGCTTCGCGGCTGACTTTGTAAACTCGATCTCAAATCAAGTAAGACTAC

Name of Depositor EG Kuhlman
Chain of Custody
ATCC <-- EG Kuhlman <-- CS Hodges
Isolation Soil, North Carolina
Cross References

Nucleotide (GenBank) : KU729083 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : Y18553 Mortierella alpina ole1 gene for stearoyl-CoA desaturase.

Nucleotide (GenBank) : Y18554 Mortierella alpina ole2 gene for stearoyl-CoA desaturase.

Complete Genome (GenBank) : ADAG00000000 Mortierella alpina ATCC 32222, whole genome shotgun sequencing project

References

Bajpai PK, et al. Production of arachidonic acid by Mortierella alpina ATCC 32222. J. Ind. Microbiol. 8: 179-186, 1991. PubMed: 1367901

Bajpai P, et al. Eicosapentaenoic acid (EPA) formation: comparative studies with Mortierella strains and production by Mortierella elongata. Mycol. Res. 95: 1294-1298, 1991.

Kuhlman EG. Zygospore formation in Mortierella alpina and m. spinosa. Mycologia 67: 678-681, 1975.

Jang HD, et al. Polyunsaturated fatty acid production with Mortierella alpina by solid substrate fermentation. Bot. Bull. Acad. Sinica 41: 41-48, 2000.

Tough AJ, et al. Hetero-azeotropic distillation: combining fungal dehydration and lipid extraction. J. Biosci. Bioeng. 90: 37-42, 2000.

Wang L, et al. Genome characterization of the oleaginous fungus Mortierella alpina. PLoS One 6: e28319, 2011. PubMed: 22174787

Ren Y, et al. Biochemical characterization of GDP-L-fucose de novo synthesis pathway in fungus Mortierella alpina. Biochem Biophys Res Commun 391: 1663-1669, 2010. PubMed: 20035716

Ho SY, Chen F. Genetic characterization of Mortierella alpina by sequencing the 18S-28S ribosomal gene internal transcribed spacer region. Lett Appl Microbiol 47: 250-255, 2008. PubMed: 19241518

MacKenzie DA, , et al. A third fatty acid delta9-desaturase from Mortierella alpina with a different substrate specificity to ole1p and ole2p. Microbiology 148: 1725-1735, 2002. PubMed: 12055292

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation