Scheffersomyces shehatae (Buckley et van Uden) Urbina et Blackwell (ATCC® 22984)

Strain Designations: M 175 [NRC 2883]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Candida shehatae Buckley et van Uden, anamorph
Strain Designations M 175 [NRC 2883]
Application
Bioethanol production
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments Ferments xylose
Increase in ploidy during stress
Genome sequencing strain (Nanjing Forestry University, China)
Medium Medium 28: Emmons' modification of Sabouraud's agar
Medium 200: YM agar or YM broth
Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGTATTCTTTTTGCCAGCGCTTAACTGCGCGGCGAAAAAACCTTACACACAGTGTTTTCTTTATTAGAAACTATTGCTTTGGTCTGGCTTAGAAATAAGTTGGGCCAGAGGTTAACCAAACTTCAATTTTATTATTGAATTGTTATTTTATTTAATTTGTCAATTTGTTGATTAAATTCAAAAAATCTTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATATGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAGCCCTCGGGTTTGGTATTGAGTGATACTCTTAGTCAGACTAGGCGTTTGCTTGAAAAGTATCGGCATGAGTAGTACTAGATAGTGCTTTCAGGATATTTCAATGTATTAGGTTTATCCAACTCGTTGAGAATTCTTGGTAGTGAATTTTTAGTATCATGGCTCTGCCTTACAAAACAACAAACAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGTCTTAGTAACGGCGAGTGAAGCGACAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGTCCAACTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGTTTGAGATCAGACTTGGTATTTTGTATGTCTTGCTTTCGGGTGGGGCCTCTGCAGTTTACTGGGCCAGCATCGGTTTGGACGGTAGGATAATGACATTGGAATGTGGCACTACTTCGGTGGTGTGTTATAGACTTTGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTGACTAGGATGCTGGCATAATGATCCTAAACCGC

Name of Depositor SA Meyer
Cross References

Nucleotide (GenBank) : JQ023135 RPB 1 gene

Nucleotide (GenBank) : HQ652024 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : HQ652065 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JQ023147 RPB 2 gene

Nucleotide (GenBank) : KC479677 18S rRNA gene

Nucleotide (GenBank) : KC507458 EF-1 alpha gene

Nucleotide (GenBank) : KC479711 XYL1 gene

References

Alexander MA, et al. Levels of pentose phosphate pathway enzymes from Candida shehatae grown in continuous culture. Appl. Microbiol. Biotechnol. 29: 282-288, 1988.

Hinfray CT, et al. Influence of the oxygenation level on D-xylose fermentation by free and agar-entrapped cultures of C. shehatae. Appl Microbiol Biotechnol 42: 682-687, 1995

Jeffries TW. Effects of culture conditions on the fermentation of xylose to ethanol by Candida shehatae. Biotechnol. Bioeng. Symp. 15: 149-166, 1985.

Lee H, Fisher BG. Unusual fructose utilization by Pichia stipitis and its potential application. J. Ferment. Bioeng. 69: 79-82, 1990.

Palnitkar S, Lachke A. Effect of nitrogen sources on oxidoreductive enzymes and ethanol production during D-xylose fermentation by Candida shehatae. Can. J. Microbiol. 38: 258-260, 1992. PubMed: 1393828

Suh SO, et al. Scheffersomyces parashehatae f.a., sp. nov., Scheffersomyces xylosifermentans f.a., sp. nov., Candida broadrunensis sp. nov., and Candida manassasensis sp. nov., four novel yeasts associated with wood- ingesting insects and their ecological and biofuel implications. Int. J. Syst. Evol. Microbiol. 63: 4330-4339, 2013. PubMed: 24014624

Talbot NJ, Wayman M. Increase in ploidy in yeasts as a response to stressing media. Appl Microbiol Biotechnol 32: 167-169, 1989

Yang VW, Jeffries TW. Purification and properties of xylitol dehydrogenase from the xylose-fermenting yeast Candida shehatae. Appl Biochem Biotechnol 26: 197-206, 1990

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation