Komagataella phaffii Kurtzman (ATCC® 20864)

Strain Designations: GS115 [SMD 83]  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Pichia pastoris (Guilliermond) Phaff, teleomorph
Strain Designations GS115 [SMD 83]
Application
Transformation host
Transformation host for expression of beta-galactosidase
Transformation host for expression of epidermal growth factor
Transformation host for expression of alcohol oxidase
Transformation host for expression of recombinant Bordetella pertussis pertactin
Transformation host for expression of Bacillus stearothermophilus alanine carboxypeptidase gene, dacA
Transformation host for expression of HIV-1 envelope protein
Transformation host for expression of Geotrichum candidum lipase A and B
Transformation host for expression of recombinant human serum albumin
Transformation host for expression of recombinant human angiostatin
Transformation host for expression of synthetic tick anticoagulant peptide gene
Transformation host for expression of bovine enterokinase
Transformation host for expression of coffee bean alpha-galactosidase
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Genotype AOX1 his4-
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Protein secretory pathway
Screening for muliple copy gene inserts
Komagataella pastoris was once used as a synonym for Pichia pastoris.
The sequences from the D1D2 region of LSU rDNA identified this strain as Komagataella phaffii.
Genome sequencing strain (Unit for Molecular Glycobiology, Department for Molecular Biomedical Research, VIB, UGent, Belgium).
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
D1/D2 region of 26S ribosomal RNA gene

GGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGTCCACCTTTGAAGTATTGACGTGGTTGGGAGAGGCAATGTGCACAAGTCGCCTGGAACGGCCGCCAAAGAGGGTGATAGCCCCGTAGCACGGTCAACCTTCCCAGCCGACAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAAGGTGGTAGGGTCCATCAAAGACTAAATATCAGCGAGAGACCGATAGCAAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAACAGTGCGTGAAATTGGGGGGAGGG

Name of Depositor SIBIA, Inc.
Isolation
Mutant derived from NRRL Y-11430
References

Buckholz RG. Pichia pastoris acid phosphatase gene, gene regions, signal sequence and expression vectors comprising same. US Patent 5,268,273 dated Dec 7 1993

Vozza LA, et al. Production of a recombinant bovine enterokinase catalytic subunit in the methylotrophic yeast Pichia pastoris. Bio-Technology 14: 77-81, 1996. PubMed: 9636316

Payne WE, et al. An inducible acid phosphatase from the yeast Pichia pastoris: characterization of the gene and its product. Gene 163: 19-26, 1995. PubMed: 7557473

Zhu A, et al. High-level expression and purification of coffee bean alpha- galactosidase produced in the yeast Pichia pastoris. Arch. Biochem. Biophys. 324: 65-70, 1995. PubMed: 7503561

Cregg JM, et al. Pichia pastoris as a host system for transformations. Mol. Cell. Biol. 5: 3376-3385, 1985. PubMed: 3915774

Laroche Y, et al. High-level secretion and very efficient isotopic labeling of tick anticoagulant peptide (TAP) expressed in the methylotrophic yeast, Pichia pastoris. Bio-Technology 12: 1119-1124, 1994. PubMed: 7765555

Wagner LW, et al. Use of a silicone tubing sensor to control methanol concentration during fed batch fermentation of Pichia pastoris. Biotechnol. Tech. 11: 791-795, 1997.

Catoni E, et al. Overexpression of lipase A and B of Geotrichum candidum in Pichia pastoris: high-level production and some properties of functional expressed lipase B. Biotechnol. Tech. 11: 689-695, 1997.

Fairlie WD, et al. Screening procedure for Pichia pastoris clones containing multiple copy gene inserts. BioTechniques 26: 1042-1044, 1999. PubMed: 10376135

Siegel RS, et al. Production of epidermal growth factor in Pichia pastoris yeast cells. US Patent 5,102,789 dated Apr 7 1992

de Hoop MJ, et al. Overexpression of alcohol oxidase in Pichia pastoris. FEBS Lett. 291: 299-302, 1991. PubMed: 1936277

Romanos MA, et al. Recombinant Bordetella pertussis pertactin (P69) from the yeast Pichia pastoris: high-level production and immunological properties. Vaccine 9: 901-906, 1991. PubMed: 1811375

Despreaux CW, Manning RF. The dacA gene of Bacillus stearothermophilus coding for D-alanine carboxypeptidase: cloning, structure and expression in Escherichia coli and Pichia pastoris. Gene 131: 35-41, 1993. PubMed: 8370539

Scorer CA, et al. The intracellular production and secretion of HIV-1 envelope protein in the methylotrophic yeast Pichia pastoris. Gene 136: 111-119, 1993. PubMed: 8293993

Kobayashi K, et al. High-level expression of recombinant human serum albumin from the methylotrophic yeast Pichia pastoris with minimal protease production and activation. J. Biosci. Bioeng. 89: 55-61, 2000.

Lin J, et al. Production process for recombinant human angiostatin in Pichia pastoris. J. Ind. Microbiol. Biotechnol. 24: 31-35, 2000.

Liu Y, et al. Preparation of high-activity whole cell biocatalysis by permeabilization of recombinant yeasts with alcohol. J. Biosci. Bioeng. 89: 554-558, 2000.

De Schutter K, et al. Genome sequence of the recombinant protein production host Pichia pastoris. Nat. Biotechnol. 27: 561-566, 2009. PubMed: 19465926

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation