Piriformospora indica Verma et al. (ATCC® 204458)

Strain Designations: END1 [DSM 11827]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations END1 [DSM 11827]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Comments Genome sequencing strain (Institute of Bioinformatics and Systems Biology, Helmholtz Zentrum München, Neuherberg, Germany)
A biotrophic symbiont that colonizes the root cortex cells of a broad range of plant species
Morphology On PDA medium at 30°C after 10 days, mycelium creamy white to buff, velutionous, forming zonations of texture. Reverese creamy white to buff. Hyphae hyaline. Chlamydospores abundant, hyaline, light-bulb to pear shaped, guttulate, 16-21 X 14.5-18 µm.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTAACGAATTTCGATTCGGTCTTCTGTGCTGGTGGCAACACATGTGCACGTCGATCGTAATTCCATCCTCCTTTCAATTGTCCAAGTGCGTTCGGTCGGCCTCTGGGTCGAAGAAGCGTGGCTGCCAGGCTCGTTTCGTTCTGAATGCACATTGGTTATTTCACCCACTCTGGGTACTAGAAACAAAGAAATATTCATATAAACTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACGCCCGTTTGAGTGTCGTTGTACTCTCAATCCTACAATTTTTGTTGTACGGATTGGACTTGGGTCCTGTTGCGCTCTGCAACTGATCCGAAATGTATCAGCGTGTGTCCGTCGTGACGATGAACCGATTGTTAAGTTTCATCGGGCTCGCTTTGTCGAGGTCGTCTGACGAAATGCATGCCTAACCCTCCTATACTTTGACAATTCGACCTCAAATCGGGTGGGATCACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAAAGCTCAAATTTTGAATCTGGCGCCTTTGGCTCCCGAGTTGTAATCTAGAGAAGTGTCTTCCGCATCGGACCGTGTACAAGTTCCCTGGAACGGGACGTCATAGAGGGTGAGAATCCCGTACATGCCACGGACTACCTTTGCTCTGTGATACACTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTTTGGAGTCAGTCGCGTCTGGCGGGATTCAGCCTTGCTTCTGCTTGGTGTATTTCCTGTCCGACGGGTCAGTGTCGATTTCGACTGAGGGAAAAAGGCTTGGGGAATGTGGCCATCTTCGGGTGGTGTTATAGCCCCTTGTTGTATGTCTCAGTTGGGATCGAGGTCAGCAGCGCGCCTTTTGGCCGGGGTTCGCGCCCTCGGTACGCGCTTAGGACACTGGCATAATGGCTTTAAGCGA

Morphology On PDA medium at 30°C after 10 days, mycelium creamy white to buff, velutionous, forming zonations of texture. Reverese creamy white to buff. Hyphae hyaline. Chlamydospores abundant, hyaline, light-bulb to pear shaped, guttulate, 16-21 X 14.5-18 µm.
Name of Depositor P Franken
Chain of Custody
ATCC <-- P Franken <-- S Verma
Isolation Arbuscular mycorrhizal spores in the rhizosphere soils of Prosopis juliflora and Zizyphus nummularia, Thar desert, Western India, India.
Cross References

Nucleotide (GenBank) : AF014929 nucleotide sequence of 5' region of 18S rRNA

References

Verma S, et al. Piriformospora indica, gen. et sp. nov., a new root-colonizing fungus. Mycologia 90: 896-903, 1998.

Zuccaro A, et al. Endophytic life strategies decoded by genome and transcriptome analyses of the mutualistic root symbiont Piriformospora indica. PLoS Pathogens 7(10): e1002290, 2011. PubMed: 22022265

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation