Rhodosporidium toruloides Banno, teleomorph (ATCC® 204091)

Strain Designations: IIP 30 [MTCC 1151]  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Rhodotorula glutinis (Fresenius) Harrison, anamorph
Strain Designations IIP 30 [MTCC 1151]
Synonym Torula rubescens Saito
Mycotorula rubescens (Saito) Ciferri et Redaelli
Rhodotorula rubescens (Saito) Harrison
Torula koishikawensis Okunuki
Rhodotorula koishikawensis (Okunuki) Krasilnikov
Rhodotorula glutinis (Fresenius) Harrison var. rubescens (Saito) Lodder
Rhodotorula gracilis Rennerfelt
Rhodotorula glutinis (Fresenius) Harrison var. rufusa Iizuka et Goto
Application
produces lipids
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments Genome sequencing strain (Mississippi State University, USA)

The sequences of D1/D2 region and ITS from this strain are highly similar (99-100%) to those of ATCC 10657, type strain of Rhodosporidium toruloides.
Medium ATCC® Medium 1245: YEPD
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
Growth Conditions
Temperature: 25°C to 30°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGAATATTAGGGTGTCCAACTTAACTTGGAGCCCGACCCTCACTTTCTAACCCTGTGCATTTGTCTTGGGTAGTAGCTCGCGTCAGCGAGCGAATCCCATTTCACTTACAAACACAAAGTCTATGAATGTAACAAATTTATAACAAACAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCATGGTATTCCGTGGAGCATGCCTGTTTGAGTGTCATGAATTCTTCAACCCACCTCTTTCTTAGTGAATCAGGCGGTGTTTGGATTCTGAGCGTTGCTGGCTTCGCGGCCTAGCTCGCTCGTAATGCATTAGCATCCGCAATCGAACTTCGGATTGACTCGGCGTAATAGACTATTCGCTGAGGATTCTGGTCTCTGACTGGAGCCGGGTAAGATTAAAGGAAGCTACCAATCCTCATGTCTATCTTTTGAGATTAGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAGCGGCGAGCGAAGCGGGAAGAGCTCAAATTTGTAATCTGGCACCTTCGGTGTCCGAGTTGTAATCTCTAGAAGTGTTTTCCGCGTTGGACCGCACACAAGTCTGTTGGAATACAGCGGCATAGTGGTGATACCCCATTACACGGTGCGGACGCCCAGCGCTTTGTGATACACTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAGTACGTGAAATTGTTGGAAGGGAAACGCTTGAAGTCAGACTTGCTTGCCGGGCTTGCTCGGTTTGCAGGCCAGCATCAGTTTTCTGGGACGGATAATGGCAGTTAGAATGTAGCAGTCTCGGCTGTGTTATAGCTTTCTGCTGGATACGTCCTGGGGGACTGAGGAACGCAGCGTGCCGTATGGCGAGGGCTTTGGTCCTTTCACGCTTAGGATGCTGGTGGAATGGCTTTAAACGAC

Name of Depositor NK Yadav
Chain of Custody
ATCC <-- NK Yadav <-- VW Johnson
Isolation
Soil, Baroda, India
References

Pathak R, Yadav NK. Influence of cultural conditions on lipid production by mutant strain of Rhodotorula glutinis MTCC 1151. Indian J. Exp. Biol. 35: 366-368, 1997. PubMed: 9315236

N K Yadav, personal communication

Yu X, et al. Oil production by oleaginous yeasts using the hydrolysate from pretreatment of wheat straw with dilute sulfuric acid. Bioresour. Technol. 102: 6134-6140, 2011. PubMed: 21463940

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation