Mucor circinelloides f. lusitanicus Schipper, teleomorph (ATCC® 1216B)

Strain Designations: [CBS 277.49, NRRL 3631]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Mucor racemosus Fresenius, teleomorph
Strain Designations [CBS 277.49, NRRL 3631]
Biosafety Level 1
Product Format freeze-dried
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Mating Type mating type minus
Comments
Translation rate
beta-Glucosidase synthesis
Dimorphism
Lipid synthesis
RNA synthesis
Mitochondrial genome
Construction of partial genomic libraries
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA).
Morphology

After 7 days at 25°C colony up to 13 mm in height, light gray; sporangiophores up to 6 (10) µm in diam., sympodially branched; sporangia at first pale yellowish then brownish black to black, up to 60 µm in diam., leaving small collars; columellae obovoid to globose, mouse-grey, up to 38 x 35 µm, infrequently larger; sporangiospores rather irregular in size and shape, ellipsoidal, a few globose, 4.4-6.1 (8) x 3.8-4.4 µm, chlamydospores and oidia in submerged mycelium; submerged mycelium containing yellow droplets..

Medium Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24.0°C
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GATCAAATTTAAAAAAGTGTTATTTGGGAGGCCCCAGCACAGTTTACCGCAAGAGCTTCTCTTTATATTAAAAAAAAGTTCAGGCATCAAACAAGATCAGGCCTTTGTACATTTCAAGAGGTTGAGATCTGACGATCAAGAGACTCTCAGTCATCCTATTCAACAAAAGTTGGATAGAGGGTTTGTTTTGATACTGAAACAGGCGTGCTCATTGGAATACCAATGAGCGCAAGTTGCGTTCAAAGACTCGTGATTCACTGAATATGCAATTCACACTAGTTATCGCACTTTGCTACGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTAAAAGTTGTTTTATAGATTTTTTACGTCTATGTTACAATATTAATCTGAATTCTTTTGGTAAATAATAATAGGATACCAAGCCTAAGCTTGATTATGACTCGGTTAACATTTCCGCTGCCTATCCTTATAGCARTGGAACATCCCTCAGGCGTCAAGTAATAATACGTTTCCAGTAAATAGATAATGATGGACAAGCCAAAA

Morphology

After 7 days at 25°C colony up to 13 mm in height, light gray; sporangiophores up to 6 (10) µm in diam., sympodially branched; sporangia at first pale yellowish then brownish black to black, up to 60 µm in diam., leaving small collars; columellae obovoid to globose, mouse-grey, up to 38 x 35 µm, infrequently larger; sporangiospores rather irregular in size and shape, ellipsoidal, a few globose, 4.4-6.1 (8) x 3.8-4.4 µm, chlamydospores and oidia in submerged mycelium; submerged mycelium containing yellow droplets..

Name of Depositor AF Blakeslee
Cross References

Nucleotide (GenBank) : M26190 M.racemosus (Zygomycetes) 25S ribosomal RNA gene.

Nucleotide (GenBank) : X15582 Mucor racemosus RPG19 gene for ribosomal protein.

Nucleotide (GenBank) : X17475 Mucor racemosus TEF-3 gene for elongation factor 1-alpha

Nucleotide (GenBank) : X17476 Mucor racemosus TEF-2 gene for elongation factor 1-alpha

Nucleotide (GenBank) : J02605 M.racemosus TEF-1 gene encoding elongation factor 1-alpha

Nucleotide (GenBank) : M16353 M.racemosus elongation factor 1-alpha (TEF-2) gene, 3' end.

Nucleotide (GenBank) : M16354 M.racemosus elongation factor 1-alpha (TEF-3) gene, 3' end.

Nucleotide (GenBank) : M20232 M.racemosus elongation factor 1-alpha (TEF-2) gene, 5' end.

Nucleotide (GenBank) : M20233 M.racemosus elongation factor 1-alpha (TEF-3) gene, 5' end.

Nucleotide (GenBank) : U07696 Rhizomucor circinelloides f. lusitanicus ATCC 1216b putative

Nucleotide (GenBank) : AJ278321 Mucor racemosus partial gpd gene for glyceraldehyde-3-phosphate

References

Mukhtar M, et al. A procedure to construct partial genomic libraries for gene cloning from fungi. BioTechniques 17: 640-642, 1994. PubMed: 7833015

Orlowski M, Sypherd PS. Regulation of translation rate during morphogenesis in the fungus Mucor. Biochemistry 17: 569-575, 1978. PubMed: 623731

Schramke ML, Orlowski M. Mitochondrial genome of the dimorphic zygomycete Mucor racemosus. Curr. Genet. 24: 337-343, 1993. PubMed: 8252644

Orlowski M, Sypherd PS. RNA synthesis during morphogenesis of the fungus Mucor racemosus. Arch. Microbiol. 119: 145-152, 1978. PubMed: 727853

Borgia P, Sypherd PS. Control of beta-glucosidase synthesis in Mucor racemosus. J. Bacteriol. 130: 812-817, 1977. PubMed: 233721

Ito ET, et al. Lipid synthesis during morphogenesis of Mucor racemosus. J. Bacteriol. 152: 880-887, 1982. PubMed: 7130131

Inderlied CB, Sypherd PS. Glucose metabolism and dimorphism in Mucor. J. Bacteriol. 133: 1282-1286, 1978. PubMed: 641009

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation