Lodderomyces elongisporus (Recca et Mrak) van der Walt, teleomorph (ATCC® 11503)

Strain Designations: 78 [CBS 2605, CCRC 21390, DBVPG 6183, IFO 1676, JCM 1781, NRRL YB-4239]  /  Product Format: freeze-dried

Deposited As Saccharomyces elongisporus Recca et Mrak, teleomorph
Strain Designations 78 [CBS 2605, CCRC 21390, DBVPG 6183, IFO 1676, JCM 1781, NRRL YB-4239]
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (Broad Institute, USA).
Medium Medium 28: Emmons' modification of Sabouraud's agar
Medium 200: YM agar or YM broth
Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGAATTTTGAGAATTGTGCTTAACTGCACTTTTCTTATCTACACACGTGTTTTTGTTTTATTCTTAAAACTTGCTTTGGCAGTGGCTGCTTAATTGCTCTGCTGCCAGAGGATAAACTCAACCTAAATTTTTTATTTTAAACTAGTCAACTGATTATATTTATTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCATTTCTCCCTCAAACCCCCGGGTTTGGTGATGAGCAATACGCCAGGTTTGCTTGAAAGTTAGGAGGAGTATTTATAACAATGTATTAGGTCTAACCACTCCATTGTGCTTAATAAAAAGCTCCAATCTATATTTCAAACTTCGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCACTTTCAGTGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGTCTAGCTCTTGTCTATGTTTCTTGGAACAGAACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGTCTAGATCTATGTAAAGTTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGTATGTTACTCTCTCGGGGGTGGCCTCTACAGTTTACCGGGCCAGCATCAGTTTGAGCGGTAGGAGAATTGCGTAGGAATGTGGCTCGGCCTCGGTCGAGTGTTATAGCCTTCGTCGATACTGCCAGCTTAGACTGAGGACTGCGGCTTCGGCCTAGGATGTTGGCATAATGATCTTAAGTCGC

Name of Depositor JA Recca
Isolation
Concentrated orange juice, California
Cross References

Nucleotide (GenBank) : HQ876050 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : HQ876042 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : HQ876033 18S rRNA gene

Nucleotide (GenBank) : KC507435 EF-1 alpha gene

Nucleotide (GenBank) : KC507404 RPB1 gene

Nucleotide (GenBank) : KC512830 RPB2 gene

References

Butler G, et al. Evolution of pathogenicity and sexual reproduction in eight Candida genomes. Nature 459: 657-662, 2009. PubMed: 19465905

Suh SO, et al. Scheffersomyces parashehatae f.a., sp. nov., Scheffersomyces xylosifermentans f.a., sp. nov., Candida broadrunensis sp. nov., and Candida manassasensis sp. nov., four novel yeasts associated with wood- ingesting insects and their ecological and biofuel implications. Int. J. Syst. Evol. Microbiol. 63: 4330-4339, 2013. PubMed: 24014624

van der Walt JP. Lodderomyces, a new genus of the Saccharomycetaceae. Antonie van Leeuwenhoek 32: 1-5, 1966. PubMed: 5296604

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009.