Candida tenuis Diddens et Lodder, anamorph (ATCC® 10573)

Strain Designations: NRRL Y-1498 [CBS 615, CCRC 21748, DBVPG 6159, IFO 10315, VKM Y-70]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations NRRL Y-1498 [CBS 615, CCRC 21748, DBVPG 6159, IFO 10315, VKM Y-70]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Type Strain yes (Diddens HA, Lodder J. Die anaskosporogenen Hefen, zweite Halfte. Amsterdam: North-Holland; 1942.)
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA; Wellcome Trust Sanger Institute, UK).
Medium ATCC® Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 24.0°C
Sequenced Data
>26S ribosomal RNA gene, partial sequence.

ACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGAATTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCCGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGGTCAGACTTGGTTTTACCAGGCCAGCATCAGTTTGGACGGCAGGATAATAGCTAAGAAATGTGACTCCACCTCGGTGGTGTGTTATAGTCTTGGTTGATACTGCCTGTCTAGACTGAGGACTGCGTCTTTGACTAGGATGCT

Name of Depositor NRRL
Chain of Custody
ATCC <<--NRRL<<--CBS 615 <<--- E.C. Holst
Isolation
bark-beetle, USA
Cross References

Complete Genome (GenBank) : AEIM00000000 Candida tenuis ATCC 10573, whole genome shotgun sequencing project

References

Diddens HA, Lodder J. Die anaskosporogenen Hefen, zweite Halfte. Amsterdam: North-Holland; 1942.

Wohlbach DJ, et al. Comparative genomics of xylose-fermenting fungi for enhanced biofuel production. Proc. Natl. Acad. Sci. USA 108: 13212-13217, 2011. PubMed: 21788494

Diddens HA, Lodder J. Die anaskosporogenen Hefen, zweite Halfte. Amsterdam: North-Holland; 1942.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation