Aspergillus clavatus Desmazieres, anamorph (ATCC® 1007)

Strain Designations: QM 1276 [ATCC 9598, ATCC 9602, CBS 513.65, CBS strain, CCC-T-191b, IMI 15949, LSHB Ac86, LSHB Ac95, MIT 213, NCTC 3887, NCTC 978, NRRL 1, NRRL 1656, QM 7404, Thom 107, WB 1]  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Strain Designations QM 1276 [ATCC 9598, ATCC 9602, CBS 513.65, CBS strain, CCC-T-191b, IMI 15949, LSHB Ac86, LSHB Ac95, MIT 213, NCTC 3887, NCTC 978, NRRL 1, NRRL 1656, QM 7404, Thom 107, WB 1]
Application
produces patulin clavacin, clavatin, claviformin
Biosafety Level 1
Product Format freeze-dried
Type Strain yes (type strain)
Intended Use
Genome Sequenced Strain

Yes

Comments
Atypical strain
Genome sequencing strain (J. Craig Venter Institute, USA).
Medium ATCC® Medium 325: Malt extract agar (Blakeslee's formula)
Growth Conditions
Temperature: 26.0°C
Sequenced Data
    18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

CTTAGACGGGGGCCATGCCCGAAGCATCCTCTGCAAATTACAATGCGGACCCCGAAGGAGCCAGCTTTCAAATTTGAGCTCTTGCCGCTTCACTCGCCGTTACTGAGGCAATCCCTGTTGGTTTCTTTTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAACCTTAGAAAAATTGGGTTGGTGTCGACAGGCGCCGGCCGGCCCTACAAGAGCGGGTGACAAAGCCCCATACGCTCGAGGACCGGACGCGGTGCCGCCGCTGCCTTTCGGGCCCGTCCCCGGGAAACCGGGGACGGGGGCCCAACACACAAGCCGTGCTTGAGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACTGAATTCTGCAATTCACATTAGTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCGTTGTTGAAAGTTTTAACTGATTATGATAATCAACTCAGACTGCAAAACTTCAGAACAGAGTTCATGTTGTGGTCTTCGGCGGGCGCGGGCCCGGGGGCGCGGAGGCCTCCCCGGCGGCCGTCCGAAGACGGCGGGCCCGCCGAAGCAACAAGGTACGATAAACACGGGTGGGAGGTTGGACCCAGAGGGCCCGCACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTAAATGACCGGGTTTGACCAACTTTCCGGCTCTGGGGGGTCGTTGCCAACTCCCCTGAGCCAGTCCGAAGGCCTCACCGAGCCATTCAATCGGTAGTAGCGACGGGCGGTGTGTACAAAGGGC

Name of Depositor QM
Chain of Custody
ATCC <<--QM<<--NRRL 1656 <<--- M.I.T. 213 <<--- ATCC 1007 <<--- C. Thom 107 <<--- CBS strain Kral
Cross References

Nucleotide (GenBank) : AAKD03000000 Aspergillus clavatus NRRL 1, whole genome shotgun sequencing project.

References

Samson RA, Gams WTypification of the species of Aspergillus and associated teleomorphsIn: Samson RA, Gams WAdvances in Penicillium and Aspergillus systematicsNew YorkPlenum Presspp. 31-54, 1985

Waksman SA, et al. The production of two antibacterial substances, fumigacin and clavacin. Science 96: 202-203, 1942.

type strain

Fedorova ND, et al. Genomic islands in the pathogenic filamentous fungus Aspergillus fumigatus. PLoS Genet. 4: e1000046, 2008.

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009.

type strain

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation