Cryptococcus neoformans (Sanfelice) Vuillemin, anamorph (ATCC® MYA-4567)

Alternate State: Filobasidiella neoformans Kwon-Chung, teleomorph  /  Strain Designations: WM629 [CBS 10079]  /  Product Format: frozen

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Strain Designations WM629 [CBS 10079]
Alternate State Filobasidiella neoformans Kwon-Chung, teleomorph
Application
Emerging infectious disease research
Biomedical Research and Development Material
Biosafety Level 2
Product Format frozen
Type Strain no
Antigenic Properties Serotype D
Genotype VNIV, AFLP2
Mating Type MATalpha
Comments
Reference strain of VN IV, AFLP2 molecular type of C. neoformans.
Sequenced Data
ITS of MYA-4567

TTTCCGTAGGTGAACCTGCGGAAGGATCAGTAGAGAATATTGGACTTTGGTCCATTTATCTACCCATCTACACCTGTGAACTGTTTATGTGCTTCGGCACGTTTTACACAAACTTCTAAATGTAATGAATGTAATCATATTATAACAATAATAAAACTTTCAACAACGGATCTCTTGGCTTCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGAGTCATGAAAATCTCAATCCCTCGGGTTTTATTACCTGTTGGACTTGGATTTGGGTGTTTGCCGCGACCTGCAAAGGACGTCGGCTCGCCTTAAATGTGTTAGTGGGAAGGTGATTACCTGTCAGCCCGGCGTAATAAGTTTCGCTGGGCCTATGGGGTAGTCTTCGGCTTGCTGATAACAACCATCTCTTTTTGTTTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAAGCATATCAAT

Name of Depositor KJ Kwon-Chung
Special Collection ATCC
Chain of Custody
ATCC <-- KJ Kwon-Chung <-- W Meyer <-- S Chen
Isolation
Human, Australia.
Cross References

Nucleotide (GenBank) : FJ914894 ITS including 5.8S rRNA gene

References

Meyer W, et al. Molecular Typing of IberoAmerican Cryptococcus neoformans Isolates. Emerg. Infect. Dis. 9: 189-195, 2003.

Meyer W. et al. Consensus multi-locus sequence typing scheme for Cryptococcus neoformans and Cryptococcus gattii. Med. Mycol. 47(6):561-570, 2009. PubMed: 19462334

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Other Documentation