Cryptococcus gattii (Vanbreus. et Takashio) Kwon-Chung et Boekhout, anamorph (ATCC® MYA-4071)

Alternate State: Filobasidiella bacillispora Kwon-Chung, teleomorph  /  Strain Designations: WM 276  /  Product Format: frozen

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Deposited As Cryptococcus bacillisporus
Strain Designations WM 276
Alternate State Filobasidiella bacillispora Kwon-Chung, teleomorph
Application
Multigene phylogeny and phenotypic characterization.
Biomedical Research and Development Material
Biosafety Level 2
Product Format frozen
Type Strain no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (Canada's Michael Smith Genome Sciences Centre, Canada; University of British Columbia, Canada).
Multigene phylogeny and phenotypic characterization.
* This isolate is infertile under Lab conditions; * For related strains, see ATCC 32609, ATCC 208821, and ATCC MYA-4093;
Morphology After 5 days on Emmons' medium at 25°C, colony is cream-colored, smooth, mucoid.  Cells are globose, single or with bud.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
>Cryptococcus gattii ATCC MYA-4071 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence
AAGGATCAGTAGAGAATGCTGGGCTTCGGTCCATTTATCTACCCATCTACACCTGTGAACTGTTTATGTGCTTCGGCACGTTTTACACAAACTTCTAAATGTAATGAATGTAATCTTATTATAACAATAATAAAACTTTCAACAACGGATCTCTTGGCTTCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGAGTCATGAAAATCTCAATCCCTCGGGTTTTATTACCTGTTGGACTTGGATTTGGGTGTTTGCCGCGACCTGCAAAGGACGTCGGCTCGCCTTAAATGTGTTAGTGGGAAGGTGATTACCTGTCAGCCCGGCGTAATAAGTTTCGCTGGGCCTATGGGGTAGTCTTCGGCTTGCTGATAACAACCATCTCTTTTTTGTTTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAA
>Large subunit ribosomal RNA gene, partial sequence.
ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTTAGTAACGGCGAGTGAACCGGGAAGAGCTCAAATTTGAAATCTGGCGTCCTCCGGGCGTCCGAGTTGTAATCTACAGAAACGTTTTCCGTGCTGGACCGTGTCTAAGTCCCTTGGAATAGGGTATCAAAGAGGGTGACAATCCCGTACTTGACACGATCACCAGTGCTCTGTGATACGTTTTCTACGAGTCGCGTTACTTGGGAGTGTAGCGCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGTGGAAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTCTATTGGGTTCAGCCAGCTCTGCTGGTGTATTCCCTTTAGACGGGTCAACATCAGTTCTGATCGGTGGATAAGGGCTGGAGGAATGTGGCACTCTTCGGGGTGTGTTATAGCCTCCTGTCGCATACACTGGTTGGGACTGAGGAATGCAGCTCGCCTTTATGGCCGGGGTTCGCCCACGTTCGAGCTTAGGATGTTGACAAAATGGCTTTAAACGA
Morphology After 5 days on Emmons' medium at 25°C, colony is cream-colored, smooth, mucoid.  Cells are globose, single or with bud.
Name of Depositor JW Kronstad, TC Sorrell
Special Collection NSF - Mycology
Chain of Custody
T C Sorrell
J W Kronstad University of British Columbia
Isolation
Eucalyptus tereticornis debris
Australia
Isolation date: December, 1993
Geographical Isolation Mt. Anan Botanical Gardens, Sydney Australia
Year of Origin December, 1993
References

Guanggan Hu, Kronstad James W.. Gene disruption in Cryptococcus neoformans and Cryptococcus gattii by in vitro transposition. Curr. Genet. 49: 341-350, 2006.

Sudha C, et al. Selection of optimal host strain for molecular pathogenesis studies on Cryptococcus gattii. Mycopathologia 160: 207-215, 2005.

Findley K, et al. Phylogeny and phenotypic characterization of pathogenic Cryptococcus species and closely related saprobic taxa in the Tremellales. Eukaryot. Cell 8: 353-361, 2009.

Meyer W. et al. Consensus multi-locus sequence typing scheme for Cryptococcus neoformans and Cryptococcus gattii. Med. Mycol. 47(6):561-570, 2009. PubMed: 19462334

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation