Candida dubliniensis Sullivan et al., anamorph (ATCC® MYA-180)

Strain Designations: CD411  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations CD411
Application
Biomedical Research and Development Material
Biosafety Level 2
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Morphology After 6 days YEPD at 30°C, colonies white, smooth, butyrous. Cells subglobose or ellipsoid, single or in clusters. Pseudohyphae not observed.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTGTTCTGGACAAACTTGCTTTGGCGGTGGGCCCCTGCCTGCCGCCAGAGGACATAAACTTACAACCAAATTTTTTATAAACTTGTCACGAGATTATTTTTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCGTTTCTCCCTCAAACCCCTAGGGTTTGGTGTTGAGCAATACGACTTGGGTTTGCTTGAAAGATGATAGTGGTATAAGGCGGAGATGCTTGACAATGGCTTAGGTGTAACCAAAAACATTGCTAAGGCGGTCTCTGGCGTCGCCCATTTTATTCTTCAAACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGGCCCGGGTCTATGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCAAGTTACTCTTTCGGGGGTGGCCTCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGTAGGATAATGGCGGGGGAATGTGGCACGACTTTGGTTGTGTGTTATAGCCTCTGACGATACTGCCAGCCTAGACCGAGGACTGCGGTTTTTACCTAGGATGTTGGCATAATGATCTTAAGTCGC

Morphology After 6 days YEPD at 30°C, colonies white, smooth, butyrous. Cells subglobose or ellipsoid, single or in clusters. Pseudohyphae not observed.
Name of Depositor DJ Sullivan
Special Collection NCRR Contract
Isolation
Clinical specimen - human
Year of Origin 1999
References

human oral cavity, Ireland

Derek J Trinity College, Dublin, personal communication

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation