Candida dubliniensis Sullivan et al., anamorph (ATCC® MYA-180)

Strain Designations: CD411  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations CD411
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety  classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Morphology After 6 days YEPD at 30°C, colonies white, smooth, butyrous. Cells subglobose or ellipsoid, single or in clusters. Pseudohyphae not observed.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTGTTCTGGACAAACTTGCTTTGGCGGTGGGCCCCTGCCTGCCGCCAGAGGACATAAACTTACAACCAAATTTTTTATAAACTTGTCACGAGATTATTTTTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCGTTTCTCCCTCAAACCCCTAGGGTTTGGTGTTGAGCAATACGACTTGGGTTTGCTTGAAAGATGATAGTGGTATAAGGCGGAGATGCTTGACAATGGCTTAGGTGTAACCAAAAACATTGCTAAGGCGGTCTCTGGCGTCGCCCATTTTATTCTTCAAACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGGCCCGGGTCTATGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCAAGTTACTCTTTCGGGGGTGGCCTCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGTAGGATAATGGCGGGGGAATGTGGCACGACTTTGGTTGTGTGTTATAGCCTCTGACGATACTGCCAGCCTAGACCGAGGACTGCGGTTTTTACCTAGGATGTTGGCATAATGATCTTAAGTCGC

Morphology After 6 days YEPD at 30°C, colonies white, smooth, butyrous. Cells subglobose or ellipsoid, single or in clusters. Pseudohyphae not observed.
Name of Depositor DJ Sullivan
Special Collection NCRR Contract
Isolation
Clinical specimen - human
Year of Origin 1999
References

human oral cavity, Ireland

Derek J Trinity College, Dublin, personal communication

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation