Malassezia pachydermatis (Wiedman) Dodge, anamorph (ATCC® 96750)

Strain Designations: IP2195.93  /  Product Format: frozen

Strain Designations IP2195.93
Application
Biomedical Research and Development Material
Biosafety Level 2
Product Format frozen
Type Strain no
Preceptrol® no
Comments
authentic
Morphology

Afte 3 days at 30°C colonies cream to tan, usually somewhat small and dry.  Globose to ellipsoidal yeast cells with monopolar budding from phialides with delicate collerettes.  Buds are attached by a broad base.

Medium Medium 1072: Pityrosporum medium
Growth Conditions
Temperature: 30.0°C
Sequenced Data
     18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

CCATACGGATGCGCAAGCGTCTCTGGCGCCCAACCCACTATACATCCACAAACCCGTGTGCACTTGTGTTGCTTTGGCCTGTATGGGCGAGCGCACGCATTCAAACAAACTCGTATGGTTGTATGTACGTTGTAAACGTTGGACCGTCACTGGCCAACAAACTTTATACAACTTTCGACAACGGATCTCTTGGTTCTCCCATCGATGAAGAACGCAGCGAAACGCGATAGGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCATGGTATTCCGTGGAGCATGCCTGTTTGAGTGCCGCGAATTCTCCCACCCCAAACGGTTGCCGAAAGGTACTGTGCGGCGGAGGGGTTGGATGGGTGCTACTGCCTGTGGTGGGGAAACTACAACAGGCTCGCCCGAAATGCATTAGCGCCTCAGGACACATTCGCTACTGCTCTACAAAAGGAAGAGCAGCGAAGCGTATGGGGGGGAAAACCACCACCGGTTATTCCAAACCTCGCCTGACTGTTTTTGCGCGCATGGCATGATACGTCATTTGCTGTGTTGCGTAGGTTGGTGCGTGGGACTGTGTGAGTGCCTCTAGAGCTTTGAGAAGTGTGTTTCGTGTGCTACGAACTGAAAAAGTACATTCCTT

Morphology

Afte 3 days at 30°C colonies cream to tan, usually somewhat small and dry.  Globose to ellipsoidal yeast cells with monopolar budding from phialides with delicate collerettes.  Buds are attached by a broad base.

Name of Depositor E Gueho
Special Collection NCRR Contract
Isolation
human blood, France
Cross References

Nucleotide (GenBank) : JQ070084 ITS including 5.8S rRNA gene

References

Guillot J, et al. Confirmation of the nomenclatural status of Malassezia pachydermatis. Antonie van Leeuwenhoek 67: 173-176, 1995. PubMed: 7771764