Malassezia pachydermatis (Wiedman) Dodge, anamorph (ATCC® 96750)

Strain Designations: IP2195.93  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations IP2195.93
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety  classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Type Strain no
Preceptrol® no
Comments
authentic
Morphology

Afte 3 days at 30°C colonies cream to tan, usually somewhat small and dry.  Globose to ellipsoidal yeast cells with monopolar budding from phialides with delicate collerettes.  Buds are attached by a broad base.

Medium ATCC® Medium 1072: Pityrosporum medium
Growth Conditions
Temperature: 30.0°C
Sequenced Data
     18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

CCATACGGATGCGCAAGCGTCTCTGGCGCCCAACCCACTATACATCCACAAACCCGTGTGCACTTGTGTTGCTTTGGCCTGTATGGGCGAGCGCACGCATTCAAACAAACTCGTATGGTTGTATGTACGTTGTAAACGTTGGACCGTCACTGGCCAACAAACTTTATACAACTTTCGACAACGGATCTCTTGGTTCTCCCATCGATGAAGAACGCAGCGAAACGCGATAGGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCATGGTATTCCGTGGAGCATGCCTGTTTGAGTGCCGCGAATTCTCCCACCCCAAACGGTTGCCGAAAGGTACTGTGCGGCGGAGGGGTTGGATGGGTGCTACTGCCTGTGGTGGGGAAACTACAACAGGCTCGCCCGAAATGCATTAGCGCCTCAGGACACATTCGCTACTGCTCTACAAAAGGAAGAGCAGCGAAGCGTATGGGGGGGAAAACCACCACCGGTTATTCCAAACCTCGCCTGACTGTTTTTGCGCGCATGGCATGATACGTCATTTGCTGTGTTGCGTAGGTTGGTGCGTGGGACTGTGTGAGTGCCTCTAGAGCTTTGAGAAGTGTGTTTCGTGTGCTACGAACTGAAAAAGTACATTCCTT

Morphology

Afte 3 days at 30°C colonies cream to tan, usually somewhat small and dry.  Globose to ellipsoidal yeast cells with monopolar budding from phialides with delicate collerettes.  Buds are attached by a broad base.

Name of Depositor E Gueho
Special Collection NCRR Contract
Isolation
human blood, France
Cross References

Nucleotide (GenBank) : JQ070084 ITS including 5.8S rRNA gene

References

Guillot J, et al. Confirmation of the nomenclatural status of Malassezia pachydermatis. Antonie van Leeuwenhoek 67: 173-176, 1995. PubMed: 7771764

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation