Trichophyton tonsurans Malmsten (ATCC® 9085)

Strain Designations: 542  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Trichophyton tonsurans Malmsten, anamorph
Strain Designations 542
Application
Biomedical Research and Development Material
Biosafety Level 2
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Morphology After 4 days on Emmons’ at 25°C, colonies are white, velutinous; reverse pale yellow. Hyphae hyaline, thin-walled. After 21 days, microconidia abundant, hyaline, single-celled, clavate or teardrop-shaped. Macroconidia not observed.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTAACGCGCAGGCCGGAGGCCGGCCCCCCAGGATAGGGCCAAACGTCCGTCAGGGGTGAGCAGATGTGCGCCGGCCGTACCGCCCCATTCTTGTCTACCTTACTCGGTTGCCTCGGCGGGCCGCGCTCTCCCAGGAGAGCCGTTCGGCGAGCCTCTCTTTATAGCGGCTCAACGCTGGACCGCGCCCGCCGGAGGACAGACGCAAAAAAAAATTCTTTCAGAAGAGCTGTCAGTCTGAGCGTTAGCAAGCAAAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAGCCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCGCCCCCGTCTCTGGGGGTGCGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTTCTAGGCGAATGGGCAACAAACCAGCGCCTCCAGGACCGGCCGCCCTGGCCTCAAAATCTGTTTTATACTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCTCCCCCGGGGGCCCGAGTTGTAATTTGCAGAGGATGTTTCGGGTGCGGCCGCCGTCTAAGTTCCTTGGAACAGGACGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGGCGGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTCGGGGGCGGGGTTCAGCGGGTGCTCGTCGCCCGTGTATTCCTCGTTTCCCGGGCCAGCATCAGTTTCGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGTCTCTCGGGACGTCTTATAGCCGGGGGTGCAATGCGGCCCGTCGGGACTGAGGAACGCGCTCCGGCTCGGATGCTGGCGTAATGGCCGTAAGCGGC

Morphology After 4 days on Emmons’ at 25°C, colonies are white, velutinous; reverse pale yellow. Hyphae hyaline, thin-walled. After 21 days, microconidia abundant, hyaline, single-celled, clavate or teardrop-shaped. Macroconidia not observed.
Name of Depositor CW Emmons
Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation