Cunninghamella echinulata (ATCC® 90846)

Strain Designations: 1965/7.92  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Cunninghamella bertholletiae Stadel
Strain Designations 1965/7.92
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety  classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Zygomycosis
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 30°C
Atmosphere: Typical aerobic
Sequenced Data
D1D2 region of the 28S ribosomal RNA gene

AATAAGCGGAGGAAAAGAAAATAACAATGATTCCCTCAGTAACGGCGAGTGAACAGGGAAAAGCTCAAAGTTGGAACCTGGTGGGCCTAGCCTACCCGGATTGTAAACTAAAGTTTTTGGGTCGTTTAGTCAGCCAGATAAATAAGTCCTCTGGAAAGGGGCGACATAGAGGGTGAAATCCCCGTCTTTGGTCTGAGCATGATTAGGCGTTTGGCCTGGAAACGAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAAATGGGAGGTAAATCTCTCCTAAAGCTAAATATTGACGAAAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGAAAAGAGGGTCAAAAAGTACGTGAAATTGCTGAAAGGGAACCGTATAAAATCAGACTTACTGGTAGGTAATCAACCTTCCTCTCGGGGAGGGTGCACTTGCCTGCTATTGTATGCCAGCAATACTTTGGTTGGGAGGAAAAAAGTAGGAGAAATGTAGCCTGGGTTTCGGCTTAGGTGTTATAGTCTCTTGCAAAATACTCTCGGCTGGAGTAAGGAACGCAGCAAACCGTAAGGCGAAGATTTTGGGCGCTTGGAGTTAATAGTTGGAGAATTTCTGCTTCGGGTGGTGCTTCAGCTATTGATTTTAACTCGCTTAAAGTTCTTTTAATTTGCTTAGGTTGTTGGCTTAATGATTTTATATGA


Elongation factor 1-alpha gene(EF)

TCCGTTCCTTTCGTCCCCATTTCTGGCTGGCACGGTGATAACATGTTGGAAGAATCCAAGAACATGGATTGGTTCAAGGGATGGACCAAGGAAACCAAGACTGGTTCTTACAAGGGTAAGACTCTCTTAGAAGCTATTGATGCTATCGAACCTCCTACCCGTCCTTCCGACAAGCCTTTACGTCTTCCTTTACAAGATGTTTACAAGATTGGTGGTATTGGTACCGTCCCTGTAGGTCGTGTTGAAACTGGTGTCATCAAAGCTGGTATGGTTGTTACCTTCGCCCCTGCTAACGTTACCACTGAAGTTAAGTCCGTTGAAATGCATCACGAACAATTAGAACAAGGTGTTCCCGGTGACAACGTTGGTTTCAACGTCAAGAACGTTTCCGTTAAGGATATCCGTCGTGGTAACGTCTGTTCCGACTCCAAGAACGACCCTGCTAAGGAATCCGCTTCCTTCACCGCTCAAGTTATCGTCTTGAACC

Name of Depositor H Dermoumi
Special Collection NCRR Contract
Isolation
Human bronchial secretion, Germany
References

Dermoumi H. A rare zygomycosis due to Cunninghamella bertholletiae. Mycoses 36: 293-294, 1993. PubMed: 8015559

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation