Madurella mycetomatis (Laveran) Brumpt (ATCC® 64780)

Strain Designations: F75/85  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Madurella mycetomi (Laveran) Brumpt
Strain Designations F75/85
Application
Biomedical Research and Development Material
Biosafety Level 2
Product Format frozen
Type Strain no
Preceptrol® no
Medium ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 28.0°C
Sequenced Data

   18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TGCGGAGGGATCATTACAGAGTTGCAAAACTCCCCAAACCATTGTGAACATACCCCCAAAACCGTTGCTTCGGCGGGCGGCACCCCCGGGCCTCCCGGTAGTGTAGTGTCCCTCGGCCCCCTCCGCGGGGCGTCCGCCGGAGGATTATACAACACCCTATTTGCTCTGTACGGCCTCTCTGAGTCTTCTGTACTGAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAGCCCCCGGGCTTGTGTTGGGGACCTGCGGCTGTCCGCAGGCCCTGAAAACCAGTGGCGGGCTCGCTGGTCACCCCGAGCGTAGTAGTTATATCCAACTCGCCCAGGGCGTGCTGCGGGCTCCGGCCGTTAAAGCCCAACTCATTTTTACCCCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATA

Name of Depositor A Thammayya
Chain of Custody
ATCC <<--A Thammayya<<--Dr. Hemashettar
Isolation
human, India
Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation