Pythium destruens Shipton (ATCC® 64221)

Strain Designations: S5  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations S5
Application
Biomedical Research and Development Material
Biosafety Level 2
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes (type strain)
Preceptrol® no
Comments Equine pythiosis
This species is considered as synonym of Pythium insidiosum
Morphology Colonies on Cornmeal agar after 15 days at 25°C, appressed and off-white. Hyphae are hyaline and guttulate. Sporangia and oogonia were not observed.
Medium ATCC® Medium 307: Cornmeal agar
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TTCCACGTGAACCGTTCTAAATATGTTCTGTGCTTCGTCGAAGCAAACTGCTCTCTTTTTGAGAGTGGTGCGCGACGGCTTGAGGCTGAACGAAGGTTGGCTCAGTACTCGTATGACTCTCGGGTTGTGCGGTGGAACAGCTTGCCGATGTCTTTTTCAAACCCATTTTACTAAACACTGATCTATACTCCGAGGACGAAAGTCTTTGGTTTTAATCCATTAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTCTGTGTAGTCAGGAATGGAGATGGCAGAATGTGAGGTGTCTCGAGCCGTCCCCTCTTTTGGGA


D1D2 region of the 28S ribosomal RNA gene

CATATTAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGTGCAGGTTCTGCATGGCGAATTGTAGTCTATGGAGGCGATGTCAGTGCGGTTGTGCGGGATAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTGCCTGTGCAGCTGCGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAATCGAATCGTTTCCAGTGTCTATAATCCATGACATATTTCATTGGCGCGTGAATGCGTGCAGCGTTTTGGAAGTGGGTTTCCTCTCCTGGCGTTGTTGTGCGTTTGCTTGCTGGTGCCCTGTGTTGTGGTGGGACGTCAGAGTCAGTTCGTATGCCGCGGGAAATGGCTGTCAGGGAGGTAGGTCGCTTCGGTGGCTGTTATAGCCTGGCAGTTAGTAGTCGTGGTTGGGACTGAGGTGCCTACAACGCGCTTTCGAGTCTGCGGGACTCTCGTCTGGTTGCCTGCTTGGACAGCTTGCTGTGCTAGTGGTCACATCGGGCGATTGAGATCTGTAGTAACTTGTTGCCGTTCGGGACTTTGACGAAATGGAGCGATTCGTC

Morphology Colonies on Cornmeal agar after 15 days at 25°C, appressed and off-white. Hyphae are hyaline and guttulate. Sporangia and oogonia were not observed.
Name of Depositor WA Shipton
Chain of Custody
ATCC <-- WA Shipton <-- RI Miller
Isolation
Horse, Australia
References

Schurko AM, et al. A molecular phylogeny of Pythium insidiosum. Mycol. Res. 107: 537-544, 2003. PubMed: 12884950

Shipton WA. Pythium destruens sp. nov., an agent of equine pythiosis. J. Med. Vet. Mycol. 25: 137-151, 1987. PubMed: 3612431

type strain

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation