Pythium destruens Shipton (ATCC® 64220)

Strain Designations: 2802  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations 2802
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety  classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Equine pythiosis
Morphology After 15 days on Cornmeal agar at 25°C, colony is flat, off-white, furrowed. Hyphae are hyaline, guttulate, sparsely septate. Sporangia and oogonia were not observed.
Medium ATCC® Medium 307: Cornmeal agar
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

AAGGATCATTACCACACCTAAAAAACTTTCCACGTGAACCGTTCTAAATATGTTCTGTGCTTCGTCGAAGCAAACTGCTCTCTTTTTGAGAGTGGTGCGCGACGGCTTGAGGCTGAACGAAGGTTGGCTCAGTACTCGTATGACTCTCGGGTTGTGCGGTGGAACAGCTTGCCGATGTCTTTTTCAAACCCATTTTACTAAACACTGATCTATACTCCGAGGACGAAAGTCTTTGGTTTTAATCCATTAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTCTGTGTAGTCAGGAATGGAGATGGCAGAATGTGAGGTGTCTCGAGCCGTCCCCTCTTTTTGGGAGATAGCACGAGTCCCTTTAAATGTACGTTGATCTCTCTTGTGTCTTAGTGAAGTGTAATGCTCGAACGCAGTGATCTGTTCAGATTGCTTTGCGCTGGTGGGCGACTTCGGAAAGGACATTAAGGAGATGACCTCTATTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGACGGGGTGTTGTTTCCGTTCTTTCCTTGAGGTGTACCTGTCGTGTGTGAGGTCGAACTGGACGCTGGTTATTGTGTAGTAGAGTATTGCTGCGCTTTGACGCCTTCGGGTAAAGAGGACGACACTAATTTGGGAACAGAAACTGCGGCTTGCTGCGGATTCTGAACTTTTTCAAATTGGACCTGATATCAGGCAAGACTACCCGCTGA


D1D2 region of the 28S ribosomal RNA gene.

CATATTAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGTGCAGGTTCTGCATGGCGAATTGTAGTCTATGGAGGCGATGTCAGTGCGGTTGTGCGGGATAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTGCCTGTGCAGCTGCGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAATCGAATCGTTTCCAGTGTCTATAATCCATGACATATTTCATTGGCGCGTGAATGCGTGCAGCGTTTTGGAAGTGGGTTTCCTCTCCTGGCGTTGTTGTGCGTTTGCTTGCTGGTGCCCTGTGTTGTGGTGGGACGTCAGAGTCAGTTCGTATGCCGCGGGAAATGGCTGTCAGGGAGGTAGGTCGCTTCGGTGGCTGTTATAGCCTGGCAGTTAGTAGTCGTGGTTGGGACTGAGGTGCCTACAACGCGCTTTCGAGTCTGCGGGACTCTCGTCTGGTTGCCTGCTTGGACAGCTTGCTGTGCTAGTGGTCACATCGGGCGATTGAGATCTGTAGTAACTTGTTGCCGTTCGGGACTTTGACGAAATGGAGCGATTCGTC

Morphology After 15 days on Cornmeal agar at 25°C, colony is flat, off-white, furrowed. Hyphae are hyaline, guttulate, sparsely septate. Sporangia and oogonia were not observed.
Name of Depositor WA Shipton
Chain of Custody
ATCC <-- WA Shipton <-- RI Miller
Isolation
horse, Australia
References

Shipton WA. Pythium destruens sp. nov., an agent of equine pythiosis. J. Med. Vet. Mycol. 25: 137-151, 1987. PubMed: 3612431

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation