Paecilomyces lilacinus (Thom) Samson, anamorph (ATCC® 60735)

Strain Designations: M973-82  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations M973-82
Application
Biomedical Research and Development Material
Biosafety Level 2
Product Format freeze-dried
Type Strain no
Preceptrol® no
Comments
Corneal ulcer
Medium Medium 324: Malt extract agar
Medium 336: Potato dextrose agar (PDA)
Growth Conditions Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTATACAACTCCCAAACCCACTGTGAACCTTACCTCAGTTGCCTCGGCGGGAACGCCCCGGCCGCCTGCCCCCGCGCCGGCGCCGGACCCAGGCGCCCGCCGCAGGGACCCCAAACTCTCTTGCATTACGCCCAGCGGGCGGAATTTCTTCTCTGAGTTGCACAAGCAAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCCCCCCCGGGGGCCTCGGTGTTGGGGGACGGCACACCAGCCGCCCCCGAAATGCAGTGGCGACCCCGCCGCAGCCTCCCCTGCGTAGTAGCACACACCTCGCACCGGAGCGCGGAGGCGGTCACGCCGTAAAACGCCCAACTTTCTTAGAGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAA


D1/D2 region of 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCAGGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGACGCCTAGCCTGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCCCGGTGGATCATCCAGCGTTCTCGCTGGTGCACTCCGCCGGGTTCAGGCCAGCATCAGTTCGCCGCGGGGGAAAAAGGCTTCGGGAACGTGGCTCCTACGGGAGTGTTATAGCCCGTTGCATAATACCCTGGGGCGGACTGAGGTTCGCGCTCCGCTAGGATGCTGG

Name of Depositor MA Gordon
Chain of Custody
ATCC <-- MA Gordon <-- SW Norton
Isolation
human cornea, New York, USA
Cross References

Nucleotide (GenBank) : AX110162 Sequence 895 from Patent WO0123604.

Nucleotide (GenBank) : AX110167 Sequence 900 from Patent WO0123604.

References

Gordon MA, Norton SW. Corneal transplant infection by Paecilomyces lilacinus. Sabouraudia 23: 295-301, 1985. PubMed: 3901331

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation