Paecilomyces lilacinus (Thom) Samson, anamorph (ATCC® 60735)

Strain Designations: M973-82  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations M973-82
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety  classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Type Strain no
Preceptrol® no
Comments
Corneal ulcer
Medium ATCC® Medium 324: Malt extract agar
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTATACAACTCCCAAACCCACTGTGAACCTTACCTCAGTTGCCTCGGCGGGAACGCCCCGGCCGCCTGCCCCCGCGCCGGCGCCGGACCCAGGCGCCCGCCGCAGGGACCCCAAACTCTCTTGCATTACGCCCAGCGGGCGGAATTTCTTCTCTGAGTTGCACAAGCAAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCCCCCCCGGGGGCCTCGGTGTTGGGGGACGGCACACCAGCCGCCCCCGAAATGCAGTGGCGACCCCGCCGCAGCCTCCCCTGCGTAGTAGCACACACCTCGCACCGGAGCGCGGAGGCGGTCACGCCGTAAAACGCCCAACTTTCTTAGAGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAA


D1/D2 region of 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCAGGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGACGCCTAGCCTGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCCCGGTGGATCATCCAGCGTTCTCGCTGGTGCACTCCGCCGGGTTCAGGCCAGCATCAGTTCGCCGCGGGGGAAAAAGGCTTCGGGAACGTGGCTCCTACGGGAGTGTTATAGCCCGTTGCATAATACCCTGGGGCGGACTGAGGTTCGCGCTCCGCTAGGATGCTGG

Name of Depositor MA Gordon
Chain of Custody
ATCC <-- MA Gordon <-- SW Norton
Isolation
human cornea, New York, USA
Cross References

Nucleotide (GenBank) : AX110162 Sequence 895 from Patent WO0123604.

Nucleotide (GenBank) : AX110167 Sequence 900 from Patent WO0123604.

References

Gordon MA, Norton SW. Corneal transplant infection by Paecilomyces lilacinus. Sabouraudia 23: 295-301, 1985. PubMed: 3901331

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation