Blastomyces dermatitidis Gilchrist et Stokes (ATCC® 60636)

Alternate State: Ajellomyces dermatitidis McDonough et Lewis, teleomorph  /  Strain Designations: S-986  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Blastomyces dermatitidis Gilchrist et Stokes, anamorph
Strain Designations S-986
Alternate State Ajellomyces dermatitidis McDonough et Lewis, teleomorph
Application
Biomedical Research and Development Material
Emerging infectious disease research
Biosafety Level 2
Product Format frozen
Type Strain no
Preceptrol® no
Comments
Exhibits protein antigen WI-1
Medium Medium 726: Brain heart infusion with cystine
Growth Conditions
Temperature: 37.0°C
Sequenced Data
>18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TCCTAGACCGGAGGACCCCGGCCCCCTCACCTGGCCACCCTTGTCTATTTTTACCTGTTGCTTCGGCGGGCCTGCAGCGATGCTGCCGGGGGAGTTTTCACTCCCCGGGCTCGTGCCCGCCGAGGACACCGCTAGAACTTCTGGTGAACGATTGACTTCTGAAAAAAAAACTWAATCAGTTAAAACTTTCAACAACGGATCTTTTGGTTCCGACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCAACCCTCAAGCGCGGCTTGTGTGTTGGGCCTTCGTCCCCCCGTGGACGTGCCCGAAATGCAGCGGCGGCGTCGTGTTCCGGTGCCCGAGCGTATGGGGCTTTGTCACCCGCTCTAGAGGCCCGGCCGGCTCCGGCCCCATCTCAAACCCTTCGAGGGAGGGCGGTCTTCGGGCCGGTCTCCCCACCAGGTTGACCTCGGA

Name of Depositor AF DiSalvo
Chain of Custody
ATCC <<--AF DiSalvo<<--P. Morris
Isolation
soil, Eagle River bank, Wisconsin
References

Chang WL, et al. T-Cell epitopes and human leukocyte antigen restriction elements of an immunodominant antigen of Blastomyces dermatitidis. Infect. Immun. 68: 502-510, 2000. PubMed: 10639410

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation