Emmonsia parva (Emmons et Ashburn) Ciferri et Montemartini, teleomorph (ATCC® 56220)

Strain Designations: CDC B-3464 [CBS 514.14]  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Blastomyces dermatitidis Gilchrist et Stokes, anamorph
Strain Designations CDC B-3464 [CBS 514.14]
Application
Biomedical Research and Development Material
Emerging infectious disease research
Biosafety Level 2

Biosafety  classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Antigenic Properties treated as serotype 2 of Blastomyces dermatitidis RefKaufman L, et al. Detection of two Blastomyces dermatitidis serotypes by exoantigen analysis. J. Clin. Microbiol. 18: 110-114, 1983. PubMed: 6411760
Preceptrol® no
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGCGCCGTGGGGGGTCGGACCCCGAAACCCGGGGAACCCCGGCCCCCTTACCTGGCCACCCTTGTCTATCTTACCTGTTGCTTCGGCGGGCCTGCAGCGATGCTGCCGGGGGAGCCTTGCTCCCCGGGCCCGTGCCCGCCGAGGACACCGCTAGAACCTCCGGTGAACGATTGACGTCTGAGATGATAACTATAATCAGTCAAAACTTTCAACAACGGATCTCTTGGTTCCGACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCAACCCTCAAGCGCGGCTTGTGTGTTGGGCCCTCGTCCCGCCCGTGGACGTGCCCGAAATGCAGCGGCGGCGTCGTGTTCCGGTGCCCGAGCGTATGGGGCTTTGTCACCCGCTCCAGAGGCCCGGCCGGCTCCGGCCCCATCTCAACCCTTTCGGGGAAGGGCGGTCTGCGGACCGGTCTCCCCAACCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCTCCTTCGGCGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGGCGTGGCCGCGGTCTAAGTCCCCTGGAACGGGGCGTCGCAGAGGGTGAGAATCCCGTCTTCGGCCGGCCGGCTTCGCCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGTCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGAGTCGGCCGCGGGGGTTCAGCGGGCATTCGTTGCCCGTGCACTCCCCCGCGGGCGGGCCAGCGTCGGTTTCGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGCCTCTCGGGGCGTCTTATAGCCGGGGGTGCAATGCGGCCAGTCGGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCTTAATGGTCGTAAGCGAC

Name of Depositor AA Padhye
Isolation
Human, Angola
References

Kaufman L, et al. Detection of two Blastomyces dermatitidis serotypes by exoantigen analysis. J. Clin. Microbiol. 18: 110-114, 1983. PubMed: 6411760

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation