Exophiala dermatitidis (Kano) de Hoog, anamorph (ATCC® 44504)

Strain Designations: JL-3 [Mel-3]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Wangiella dermatitidis (Kano) McGinnis
Strain Designations JL-3 [Mel-3]
Application
Biomedical Research and Development Material
Biosafety Level 2
Product Format freeze-dried
Type Strain no
Genotype mel3 RefBrush L, Money NP. Invasive hyphal growth in Wangiella dermatitidis is induced by stab inoculation and shows dependence upon melanin biosynthesis. Fungal Genet. Biol. 28: 190-200, 1999. PubMed: 10669584
Preceptrol® no
Comments
Synthesis of melanin-like pigments
Morphology melanin-deficient RefBrush L, Money NP. Invasive hyphal growth in Wangiella dermatitidis is induced by stab inoculation and shows dependence upon melanin biosynthesis. Fungal Genet. Biol. 28: 190-200, 1999. PubMed: 10669584
Medium Medium 28: Emmons' modification of Sabouraud's agar
Growth Conditions
Temperature: 24.0°C
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TCTTCTCAGGCCCGACCTCCCACCCTTTGTTTACCCGACCCATGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGAGGACCGCCTATTCAGGTCCTCTGGCCCGCGCCCGCCGGTAGCCAATTCTACCAAACTCTTGAATCAAATCGTGTCCAATGTCTGAGTATATTACAAAATAAAAGCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTATCACCCCTCAAGCCCCCCGGCTTGGTGTTGGACGGTCTGGTCGAGCGTTTCCGCGCGACCCCTCCCAAAGACAATGACGGCGGCCTGGTTGGACCCCCGGTACACGGAGCTTCTTCACTGAGCACGTATCGGTTTCAAGGTGTCCCCGGGACCCGGTCGACCTCTCTTGCTCCCCTGCGGGAGTGGGAGAGAACCCCCCTTTTTATCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCA

 

Morphology melanin-deficient RefBrush L, Money NP. Invasive hyphal growth in Wangiella dermatitidis is induced by stab inoculation and shows dependence upon melanin biosynthesis. Fungal Genet. Biol. 28: 190-200, 1999. PubMed: 10669584
Name of Depositor PA Geis
Isolation
albino mutant derived from ATCC 34100
Cross References

Nucleotide (GenBank) : GU256756 ITS including 5.8S rRNA gene

References

Geis PA, et al. Pentaketide metabolites of melanin synthesis in the dematiaceous fungus Wangiella dermatitidis. Arch. Microbiol. 137: 324-328, 1984. PubMed: 6539583

Schnitzler N, et al. Effect of melanin and carotenoids of Exophiala (Wangiella) dermatitidis on phagocytosis, oxidative burst, and killing by human neutrophils. Infect. Immun. 67: 94-101, 1999. PubMed: 9864201

Brush L, Money NP. Invasive hyphal growth in Wangiella dermatitidis is induced by stab inoculation and shows dependence upon melanin biosynthesis. Fungal Genet. Biol. 28: 190-200, 1999. PubMed: 10669584

Brush L, Money NP. Invasive hyphal growth in Wangiella dermatitidis is induced by stab inoculation and shows dependence upon melanin biosynthesis. Fungal Genet. Biol. 28: 190-200, 1999. PubMed: 10669584

Brush L, Money NP. Invasive hyphal growth in Wangiella dermatitidis is induced by stab inoculation and shows dependence upon melanin biosynthesis. Fungal Genet. Biol. 28: 190-200, 1999. PubMed: 10669584

Brush L, Money NP. Invasive hyphal growth in Wangiella dermatitidis is induced by stab inoculation and shows dependence upon melanin biosynthesis. Fungal Genet. Biol. 28: 190-200, 1999. PubMed: 10669584

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation