Malassezia furfur (Robin) Baillon, anamorph (ATCC® 44342)

Strain Designations: M 165/77  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Pityrosporum orbiculare Gordon, anamorph
Strain Designations M 165/77
Application
Biomedical Research and Development Material
Biosafety Level 2
Product Format frozen
Type Strain no
Preceptrol® no
Comments
Control with propylene glycol
Morphology

After 5 days at 30°C colonies cream to tan, ellipsoidal cells with monopolar budding from phialides with small collerettes.

Medium ATCC® Medium 1072: Pityrosporum medium
Growth Conditions
Temperature: 30.0°C
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

   GCAGAAGGATCATTAGTGAAAGCAAGGGCCAGCCATACGGACGGCGCTACTCGCGTACAACGTCTCTGGCGCCCAACTTTACACAATATCCACAAACCCGTGTGCACCGTTTGGATGAGTTGGCCTCGCAAGAGGCTCGGCTCTCCAATCCATTTCTACCAAACTCGTATGGTTTGTATGAACGTGGAAATCGTTGGACCGTAACTGGCCAACAACCAATAATACAACTTTCGACAACGGATCTCTTGGTCTCCCATCGATGAAGAACGCAGCGAAACGCGATAGGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCATGGTATTCCGTGGAGCATGCCTGTTTGAGTGCCTGAATTCTCTCTCCCCAAGCGGTTGCGATTGCACTGCTTTGGCGGACGAGGTTGGATGGGTGCTTCTGCCTGTTTCGCAAGAAACAGGCTCGCCCGAAATGCATTAGCGCCTTTGGGACACACTCTGAAACCGCTCTGAAAGGGAGGGCGGCAGAGGGGATGGAGGAACTCCGCCCGTCAGCTATACCAAACTTTGCCCCAGGCAAGCGCATGGCATGATACGTCATTTGCTGTGTGTGCGTCCTGAGGCAAGGGCCGATGTGGTGCCTTTGTCACTCTGTGGGTGTGTTGGTGCGCTACCAATCCTGCGTGGAGGCTGGTCTGTGCGCAAGCATGGAGCAGTTCT

Morphology

After 5 days at 30°C colonies cream to tan, ellipsoidal cells with monopolar budding from phialides with small collerettes.

Name of Depositor J Faergemann
References

Faergemann J, Fredriksson T. Antimycotic activity of propane-1,2-diol (propylene glycol). Sabouraudia 18: 163-166, 1980. PubMed: 7434130

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation