Aspergillus fumigatus Fresenius, anamorph (ATCC® 42202)

Strain Designations: Ag 507  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations Ag 507
Application
Biomedical Research and Development Material
Emerging infectious disease research
Biosafety Level 2
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Antigenic variability
cDNA library
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTCTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGGGAGGCCTTGCGCCCCCGGGCCCGCGCCCGCCGAAGACCCCAACATGAACGCTGTTCTGAAAGTATGCAGTCTGAGTTGATTATCGTAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCCGTCCCCCTCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCTGCTCTGTAGGCCCGGCCGGCGCCAGCCGACACCCAACTTTATTTTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG

Name of Depositor VP Kurup
Isolation
sputum, South Carolina Dept. of Health and Environmental Control
Cross References

Nucleotide (GenBank) : U20722 Aspergillus fumigatus Asp FII mRNA, partial cds.

Nucleotide (GenBank) : U56938 Aspergillus fumigatus Asp f2 gene, complete cds.

Nucleotide (GenBank) : AJ001732 Aspergillus fumigatus mRNA for rAsp f 4 allergen.

Nucleotide (GenBank) : AJ223315 Aspergillus fumigatus mRNA for rAsp f 7 allergen.

Nucleotide (GenBank) : AJ223327 Aspergillus fumigatus mRNA for rAsp f 9 allergen.

Nucleotide (GenBank) : AJ224333 Aspergillus fumigatus mRNA for rAsp f 8 allergen.

Nucleotide (GenBank) : AJ002026 Aspergillus fumigatus mRNA for allergen rAsp f 13.

Nucleotide (GenBank) : AJ006689 Aspergillus fumigatus mRNA for rAsp f 11 allergen.

Nucleotide (GenBank) : AJ006688 Aspergillus fumigatus mRNA for IgE-binding protein.

Nucleotide (GenBank) : AJ224865 Aspergillus fumigatus mRNA for IgE-binding protein.

Nucleotide (GenBank) : U53561 Aspergillus fumigatus manganese superoxide dismutase mRNA, partial

Nucleotide (GenBank) : U58050 Aspergillus fumigatus peroxisomal-like protein mRNA, complete cds.

Nucleotide (GenBank) : KC689321 ITS including 5.8S rRNA gene

References

Crameri R, et al. Display of expression products of cDNA libraries on phage surfaces. A versatile screening system for selective isolation of genes by specific gene-product/ligand interaction. Eur. J. Biochem. 226: 53-58, 1994. PubMed: 7957259

Kurup VP, et al. Antigenic variability of Aspergillus fumigatus strains. Microbios 19: 191-204, 1977. PubMed: 82195

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation