Aspergillus fumigatus Fresenius, anamorph (ATCC® 42202)

Strain Designations: Ag 507  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations Ag 507
Application
Biomedical Research and Development Material
Emerging infectious disease research
Biosafety Level 2

Biosafety  classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Antigenic variability
cDNA library
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTCTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGGGAGGCCTTGCGCCCCCGGGCCCGCGCCCGCCGAAGACCCCAACATGAACGCTGTTCTGAAAGTATGCAGTCTGAGTTGATTATCGTAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCCGTCCCCCTCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCTGCTCTGTAGGCCCGGCCGGCGCCAGCCGACACCCAACTTTATTTTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG

Name of Depositor VP Kurup
Isolation
sputum, South Carolina Dept. of Health and Environmental Control
Cross References

Nucleotide (GenBank) : U20722 Aspergillus fumigatus Asp FII mRNA, partial cds.

Nucleotide (GenBank) : U56938 Aspergillus fumigatus Asp f2 gene, complete cds.

Nucleotide (GenBank) : AJ001732 Aspergillus fumigatus mRNA for rAsp f 4 allergen.

Nucleotide (GenBank) : AJ223315 Aspergillus fumigatus mRNA for rAsp f 7 allergen.

Nucleotide (GenBank) : AJ223327 Aspergillus fumigatus mRNA for rAsp f 9 allergen.

Nucleotide (GenBank) : AJ224333 Aspergillus fumigatus mRNA for rAsp f 8 allergen.

Nucleotide (GenBank) : AJ002026 Aspergillus fumigatus mRNA for allergen rAsp f 13.

Nucleotide (GenBank) : AJ006689 Aspergillus fumigatus mRNA for rAsp f 11 allergen.

Nucleotide (GenBank) : AJ006688 Aspergillus fumigatus mRNA for IgE-binding protein.

Nucleotide (GenBank) : AJ224865 Aspergillus fumigatus mRNA for IgE-binding protein.

Nucleotide (GenBank) : U53561 Aspergillus fumigatus manganese superoxide dismutase mRNA, partial

Nucleotide (GenBank) : U58050 Aspergillus fumigatus peroxisomal-like protein mRNA, complete cds.

Nucleotide (GenBank) : KC689321 ITS including 5.8S rRNA gene

References

Crameri R, et al. Display of expression products of cDNA libraries on phage surfaces. A versatile screening system for selective isolation of genes by specific gene-product/ligand interaction. Eur. J. Biochem. 226: 53-58, 1994. PubMed: 7957259

Kurup VP, et al. Antigenic variability of Aspergillus fumigatus strains. Microbios 19: 191-204, 1977. PubMed: 82195

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation