Filobasidiella bacillispora Kwon-Chung (ATCC® 32609)

Alternate State: Cryptococcus gattii (Vanbreuseghem et Takashio) Kwon-Chung et Boekhout  /  Strain Designations: NIH 444 [CBS 6956]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Filobasidiella neoformans Kwon-Chung, teleomorph
Strain Designations NIH 444 [CBS 6956]
Synonym Cryptococcus hominis var. tumefaciens (Curtis) Benham, Cryptococcus hondurianus Castellani, Cryptococcus bacillisporus Kwon-Chung et Bennett, Cryptococcus neoformans var. gattii Vanbreuseghem et Takashio, Filobasidiella neoformans var. bacillispora Kwon-Chung
Alternate State Cryptococcus gattii (Vanbreuseghem et Takashio) Kwon-Chung et Boekhout
Application
Biomedical Research and Development Material
Biosafety Level 2
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes (type strain of Filobasidiella bacillispora, mating type alpha)
Antigenic Properties serotype B RefSchmeding KA, et al. Sexual compatibility between serotypes of Filobasidiella neoformans (Cryptococcus neoformans). Curr. Microbiol. 5: 133-138, 1981.
Preceptrol® no
Genome Sequenced Strain

Yes

Mating Type mating type alpha RefKwon-Chung KJ. A new species of Filobasidiella, the sexual state of Cryptococcus neoformans B and C serotypes. Mycologia 68: 942-946, 1976.
Comments Genome sequencing strain (J. Craig Venter Institute, USA)
Morphology After 3 days on YM medium at 30°C, colony is cream-colored, smooth, mucoid. Cells are globose or ovoidal, thick-walled.
Medium Medium 28: Emmons' modification of Sabouraud's agar
Medium 200: YM agar or YM broth
Medium 323: Malt agar medium
Growth Conditions Temperature: 25°C to 30°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCAGTAGAGAATACTGGACTTCGGTCCATTTATCTACCCATCTACACCTGTGAACTGTTTATGTGCTTCGGCACGTTTTACACAAACTTCTAAATGTAATGAATGTAATCTTATTATAACAATAATAAAACTTTCAACAACGGATCTCTTGGCTTCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGAGTCATGAAAATCTCAATCCCTCAGGTTTTATTACCTGTTGGACTTGGATTTGGGTGTTTGCCGCGACCTGCAAAGGACGTCGGCTCGCCTTAAATGTGTTAGTGGGAAGGTGATTACCTGTCAGCCCGGCGTAATAAGTTTCGCTGGGCCTATGGGGTAGTCTTCGGCTTGCTGATAACAACCATCTCTTTTTGTTTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene

GTCGTTTAAAGCCATTTTGTCAACATCCTAAGCTCGAACGTGGGCGAACCCCGGCCATAAAGGCGAGCTGCATTCCTCAGTCCCAACCAGTGTATGCGACAGGAGGCTATAACACACCCCGAAGAGTGCCACATTCCTCCAGCCCTTATCCACCGATCAGAACTGATGTTGACCCGTCTAAAGGGAATACACCAGCAGAACTGGCTGAACCCAATAGACACGACTGACTTCAATCGTTTCCCTTTCAACAATTTCACGTACTGTTTAACTCTCTTTCCAAAGTGCTTTTCATCTTTCCCTCACGGTACTTGTTCGCTATCGGTCTTCCACCAATATTTAGCTTTAGATGGAGTTTACCACCCATTTTGCGCTACACTCCCAAGTAACGCGACTCGTAGAAAACGTATCACAGAGCACTGGTGATCGTGTCAAGTACGGGATTGTCACCCTCTTTGATACCCTATTCCAAGGGACTTAGACACGGTCCAGCACGGAAAACGTTTCTGTAGATTACAACTCGGACGCCCGGAGGACGCCAGATTTCAAATTTGAGCTCTTCCCGGTTCACTCGCCGTTACTAAGGGAATCCTTGTTAGTTTCTTTTCCTCCGCTTATTGATATG

Morphology After 3 days on YM medium at 30°C, colony is cream-colored, smooth, mucoid. Cells are globose or ovoidal, thick-walled.
Name of Depositor KJ Kwon-Chung
Isolation
Sputum, Washington, USA
References

Kwon-Chung KJ, et al. (1557) Proposal to conserve the name Cryptococcus gattii against C. hondurianus and C. basillisporus (Basidiomycota, Hymenomycetes, Tremello-mycetidae) Taxon 51: 804-806, 2002.

type strain of Filobasidiella bacillispora, mating type alpha

Schmeding KA, et al. Sexual compatibility between serotypes of Filobasidiella neoformans (Cryptococcus neoformans). Curr. Microbiol. 5: 133-138, 1981.

Kwon-Chung KJ. A new species of Filobasidiella, the sexual state of Cryptococcus neoformans B and C serotypes. Mycologia 68: 942-946, 1976.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation