Filobasidiella bacillispora Kwon-Chung (ATCC® 32609)

Alternate State: Cryptococcus gattii (Vanbreuseghem et Takashio) Kwon-Chung et Boekhout  /  Strain Designations: NIH 444 [CBS 6956]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Filobasidiella neoformans Kwon-Chung, teleomorph
Strain Designations NIH 444 [CBS 6956]
Alternate State Cryptococcus gattii (Vanbreuseghem et Takashio) Kwon-Chung et Boekhout
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety  classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes (type strain of Filobasidiella bacillispora, mating type alpha)
Antigenic Properties serotype B RefSchmeding KA, et al. Sexual compatibility between serotypes of Filobasidiella neoformans (Cryptococcus neoformans). Curr. Microbiol. 5: 133-138, 1981.
Preceptrol® no
Genome Sequenced Strain

Yes

Mating Type mating type alpha RefKwon-Chung KJ. A new species of Filobasidiella, the sexual state of Cryptococcus neoformans B and C serotypes. Mycologia 68: 942-946, 1976.
Comments Genome sequencing strain (J. Craig Venter Institute, USA)
Morphology After 3 days on YM medium at 30°C, colony is cream-colored, smooth, mucoid. Cells are globose or ovoidal, thick-walled.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCAGTAGAGAATACTGGACTTCGGTCCATTTATCTACCCATCTACACCTGTGAACTGTTTATGTGCTTCGGCACGTTTTACACAAACTTCTAAATGTAATGAATGTAATCTTATTATAACAATAATAAAACTTTCAACAACGGATCTCTTGGCTTCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGAGTCATGAAAATCTCAATCCCTCAGGTTTTATTACCTGTTGGACTTGGATTTGGGTGTTTGCCGCGACCTGCAAAGGACGTCGGCTCGCCTTAAATGTGTTAGTGGGAAGGTGATTACCTGTCAGCCCGGCGTAATAAGTTTCGCTGGGCCTATGGGGTAGTCTTCGGCTTGCTGATAACAACCATCTCTTTTTGTTTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene

GTCGTTTAAAGCCATTTTGTCAACATCCTAAGCTCGAACGTGGGCGAACCCCGGCCATAAAGGCGAGCTGCATTCCTCAGTCCCAACCAGTGTATGCGACAGGAGGCTATAACACACCCCGAAGAGTGCCACATTCCTCCAGCCCTTATCCACCGATCAGAACTGATGTTGACCCGTCTAAAGGGAATACACCAGCAGAACTGGCTGAACCCAATAGACACGACTGACTTCAATCGTTTCCCTTTCAACAATTTCACGTACTGTTTAACTCTCTTTCCAAAGTGCTTTTCATCTTTCCCTCACGGTACTTGTTCGCTATCGGTCTTCCACCAATATTTAGCTTTAGATGGAGTTTACCACCCATTTTGCGCTACACTCCCAAGTAACGCGACTCGTAGAAAACGTATCACAGAGCACTGGTGATCGTGTCAAGTACGGGATTGTCACCCTCTTTGATACCCTATTCCAAGGGACTTAGACACGGTCCAGCACGGAAAACGTTTCTGTAGATTACAACTCGGACGCCCGGAGGACGCCAGATTTCAAATTTGAGCTCTTCCCGGTTCACTCGCCGTTACTAAGGGAATCCTTGTTAGTTTCTTTTCCTCCGCTTATTGATATG

Morphology After 3 days on YM medium at 30°C, colony is cream-colored, smooth, mucoid. Cells are globose or ovoidal, thick-walled.
Name of Depositor KJ Kwon-Chung
Isolation
Sputum, Washington, USA
References

Kwon-Chung KJ, et al. (1557) Proposal to conserve the name Cryptococcus gattii against C. hondurianus and C. basillisporus (Basidiomycota, Hymenomycetes, Tremello-mycetidae) Taxon 51: 804-806, 2002.

type strain of Filobasidiella bacillispora, mating type alpha

Schmeding KA, et al. Sexual compatibility between serotypes of Filobasidiella neoformans (Cryptococcus neoformans). Curr. Microbiol. 5: 133-138, 1981.

Kwon-Chung KJ. A new species of Filobasidiella, the sexual state of Cryptococcus neoformans B and C serotypes. Mycologia 68: 942-946, 1976.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation