Cryptococcus neoformans (Sanfelice) Vuillemin (ATCC® 32045)

Alternate State: Filobasidiella neoformans Kwon-Chung  /  Strain Designations: CBS 132 [CCRC 20528, DBVPG 6010, IFO 0608, NRRL Y-2534]  /  Product Format: freeze-dried

Deposited As Cryptococcus neoformans (Sanfelice) Vuillemin, anamorph
Strain Designations CBS 132 [CCRC 20528, DBVPG 6010, IFO 0608, NRRL Y-2534]
Alternate State Filobasidiella neoformans Kwon-Chung
Application
control strain for identification
Biomedical Research and Development Material
Emerging infectious disease research
Biosafety Level 2
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes (type strain)
Preceptrol® yes
Morphology After days on Emmons’ modification of Sabouraud’s medium at 25°C, colony is cream, butyrous, smooth and mucoid. Cells are globose, subglobose or irregular, single or in pairs. Pseudohyphae are not observed.
Medium Medium 200: YM agar or YM broth
Medium 28: Emmons' modification of Sabouraud's agar
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TTTCCGTAGGTGAACCTGCGGAAGGATCAGTAGAGAATATTGGACTTTGGTCCATTTATCTACCCATCTACACCTGTGAACTGTTTATGTGCTTCGGCACGTTTTACACAAACTTCTAAATGTAATGAATGTAATCATATTATAACAATAATAAAACTTTCAACAACGGATCTCTTGGCTTCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGAGTCATGAAAATCTCAATCCCTCGGGTTTTATTACCTGTTGGACTTGGATTTGGGTGTTTGCCGCGACCTGCAAAGGACGTCGGCTCGCCTTAAATGTGTTAGTGGGAAGGTGATTACCTGTCAGCCCGGCGTAATAAGTTTCGCTGGGCCTATGGGGTAGTCTTCGGCTTGCTGATAACAACCATCTCTTTTTGTTTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTTAGTAACGGCGAGTGAACCGGGAAGAGCTCAAATTTGAAATCTGGCGTCCTCCGGGCGTCCGAGTTGTAATCTACAGAAACGTTTTCCGTGCTGGACCGTGTCTAAGTCCCTTGGAATAGGGTATCAAAGAGGGTGACAATCCCGTACTTGACACGATCACCAGTGCTCTGTGATACGTTTTCTACGAGTCGCGTTACTTGGGAGTGTAGCGCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGTGGAAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTCTATTGGGTTCAGCCAGTTCTGCTGGTGTATTCCCTTTAGACGGGTCAACATCAGTTCTGATCGGTGGATAAGGGCTGGAGGAATGTGGCACTCTTCGGGGTGTGTTATAGCCTCCTGTCGCATACACTGGTTGGGACTGAGGAATGCAGCTCGCCTTTATGGCCGGGGTTCGCCCACGTTCGAGCTTAGGATGTTGACAAAATGGCTTTAAACGAC

Morphology After days on Emmons’ modification of Sabouraud’s medium at 25°C, colony is cream, butyrous, smooth and mucoid. Cells are globose, subglobose or irregular, single or in pairs. Pseudohyphae are not observed.
Name of Depositor CBS
Chain of Custody
ATCC <-- CBS <-- A Giordana
Isolation
Fermenting fruit juice
Cross References

Nucleotide (GenBank) : AF075484 26S ribosomal RNA gene, partial sequence

Nucleotide (GenBank) : AF218975 Filobasidiella neoformans var. neoformans strain ATCC 32045T 5.8S

References

Vanbreuseghem R, et al. Experiences with BAY b 5097. Mykosen 18: 199-211, 1975. PubMed: 1099443

Sanfelice F. Sull'azione patogena dei blastomiceti. Ann. Ig. Sper. 5: 239-262, 1895.

Fell JW, et al. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int. J. Syst. Evol. Microbiol. 50: 1351-1371, 2000. PubMed: 10843082

type strain

Meyer W. et al. Consensus multi-locus sequence typing scheme for Cryptococcus neoformans and Cryptococcus gattii. Med. Mycol. 47(6):561-570, 2009. PubMed: 19462334

type strain