Arthroderma otae (Hasegawa et Usui) McGinnis et al., teleomorph (ATCC® 28327)

Alternate State: Microsporum canis Bodin, anamorph  /  Strain Designations: VUT-74037 [CDC B-2094, IMI 197519]  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Nannizzia otae Hasegawa et Usui, teleomorph
Strain Designations VUT-74037 [CDC B-2094, IMI 197519]
Alternate State Microsporum canis Bodin, anamorph
Application
Biomedical Research and Development Material
Biosafety Level 2
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Mating Type mating type plus RefHasegawa A, Usui K. The perfect state of Microsporum canis. Jpn. J. Vet. Sci. 36: 447-449, 1974.
Comments
Mating behavior
Morphology On Emmons’ modification of Sabouraud’s medium at 25°C after 4 days, mycelium white to creamy white becoming mustard yellow, dense, velutinous to cottony. Reverse bright lemon yellow and orange. Hyphae hyaline, guttulate. Macroconidia hyaline, spindle-shaped, smooth, guttulate, mutli-septate, 57-82.5 X 9-13 µm.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTAACGCGCAAGAGGTCGAAGTTGGCCCCCGAAGCTCTTCCGTCTCCCCCCCGGGCCTCCCGGGGAGGTTGCGGGCGGCGAGGGGTGCCTCCGGCCGCACGCCCATTCTTGTCTACTGACCCGGTTGCCTCGGCGGGCCGCGCCTGCTGTGCTACAGCGGCCGTTCGGGGGGGACGCCTGAGGGGGACTCTTGTTTCCTAGGCCACGCCCCGGGCAGCGCTCGCCGGAGGATTACTCTGGAAAACACACTCTTGAAAGAACATACCGTCTGAGCGAGCAACGCAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCCCCCTCCCCAGTAACCACCCACCGCTTAGGGGGGTGGGAGGGAGGGGGACGCGCCCGAAAAGCAGTGGTCAGGCCGCGATTCCGGCTCCTGGGCGAATGGGACATACCACCGCCTCCAGGACCGGCCGGCAGGCTGGCCTAACGCACCATGTATTATTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGSGGAGGAAAAGRAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCTCCCTTGGGGGGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGGTGTGGCCGCCGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTCTTGGGCGGCCGGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACT

Morphology On Emmons’ modification of Sabouraud’s medium at 25°C after 4 days, mycelium white to creamy white becoming mustard yellow, dense, velutinous to cottony. Reverse bright lemon yellow and orange. Hyphae hyaline, guttulate. Macroconidia hyaline, spindle-shaped, smooth, guttulate, mutli-septate, 57-82.5 X 9-13 µm.
Name of Depositor A Hasegawa
Isolation
Feline ringworm, Japan
References

Weitzman I, Padhye AA. Mating behaviour of Nannizzia otae (=Microsporum canis). Mycopathologia 64: 17-22, 1978. PubMed: 714146

Hasegawa A, Usui K. The perfect state of Microsporum canis. Jpn. J. Vet. Sci. 36: 447-449, 1974.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation