Arthroderma otae (Hasegawa et Usui) McGinnis et al., teleomorph (ATCC® 28327)

Alternate State: Microsporum canis Bodin, anamorph  /  Strain Designations: VUT-74037 [CDC B-2094, IMI 197519]  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Nannizzia otae Hasegawa et Usui, teleomorph
Strain Designations VUT-74037 [CDC B-2094, IMI 197519]
Alternate State Microsporum canis Bodin, anamorph
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety  classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Mating Type mating type plus RefHasegawa A, Usui K. The perfect state of Microsporum canis. Jpn. J. Vet. Sci. 36: 447-449, 1974.
Comments
Mating behavior
Morphology On Emmons’ modification of Sabouraud’s medium at 25°C after 4 days, mycelium white to creamy white becoming mustard yellow, dense, velutinous to cottony. Reverse bright lemon yellow and orange. Hyphae hyaline, guttulate. Macroconidia hyaline, spindle-shaped, smooth, guttulate, mutli-septate, 57-82.5 X 9-13 µm.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTAACGCGCAAGAGGTCGAAGTTGGCCCCCGAAGCTCTTCCGTCTCCCCCCCGGGCCTCCCGGGGAGGTTGCGGGCGGCGAGGGGTGCCTCCGGCCGCACGCCCATTCTTGTCTACTGACCCGGTTGCCTCGGCGGGCCGCGCCTGCTGTGCTACAGCGGCCGTTCGGGGGGGACGCCTGAGGGGGACTCTTGTTTCCTAGGCCACGCCCCGGGCAGCGCTCGCCGGAGGATTACTCTGGAAAACACACTCTTGAAAGAACATACCGTCTGAGCGAGCAACGCAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCCCCCTCCCCAGTAACCACCCACCGCTTAGGGGGGTGGGAGGGAGGGGGACGCGCCCGAAAAGCAGTGGTCAGGCCGCGATTCCGGCTCCTGGGCGAATGGGACATACCACCGCCTCCAGGACCGGCCGGCAGGCTGGCCTAACGCACCATGTATTATTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGSGGAGGAAAAGRAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCTCCCTTGGGGGGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGGTGTGGCCGCCGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTCTTGGGCGGCCGGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACT

Morphology On Emmons’ modification of Sabouraud’s medium at 25°C after 4 days, mycelium white to creamy white becoming mustard yellow, dense, velutinous to cottony. Reverse bright lemon yellow and orange. Hyphae hyaline, guttulate. Macroconidia hyaline, spindle-shaped, smooth, guttulate, mutli-septate, 57-82.5 X 9-13 µm.
Name of Depositor A Hasegawa
Isolation
Feline ringworm, Japan
References

Weitzman I, Padhye AA. Mating behaviour of Nannizzia otae (=Microsporum canis). Mycopathologia 64: 17-22, 1978. PubMed: 714146

Hasegawa A, Usui K. The perfect state of Microsporum canis. Jpn. J. Vet. Sci. 36: 447-449, 1974.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation