Scedosporium aurantiacum (ATCC® 28206)

Strain Designations: VH/6199/74  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Monosporium apiospermum Saccardo, anamorph
Strain Designations VH/6199/74
Application
Biomedical Research and Development Material
Biosafety Level 2
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Morphology On Emmons’modification of Sabouraud’s medium at 25°C after 3 days, mycelium white to dingy white becoming pale gray, velutinous, slightly raised. Reverse tan. Hyphae hyaline, guttulate. Conidia subhyaline, elongated ellipsoidal to broadly ovoid, smooth, contain oil dropplets, 8.25-10.5 X 3.75-6 µm.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
Growth Conditions
Temperature: 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AGGGATCATTACAGAGTTACTACTCCAAACCCATTGTGAACCTTACCTATGTTCTGTTGCCTCGGCGGGGCGGTCGGCGCCCCCTCTCCGCGAGGAGGGGAGACGATGGACCCCCCGCCGGCAGCACCAAACTCTTGAATTTTATAGCGGATTACAAGCTCTGATTGGAAAACAAAAAAACAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGGCAGTAATCTGCCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCTCTGTTTCCCAGCGAAGCTCAGGGTCGGCGTTGGGGCGCTACGGCGAGTCTTCGCGACCCCGTAGGCCCTGAAATACAGTGGCGGTCCCGCCGCGGTTGCCTTCTGCGTAGTAAAAGTCTTCTTTTGCAAGCTTCGCATTGGGTCCCGGCGGAGGCCTGCCGTCAAACCACATTATAACTTAAGATGGTTTGACCTCGGATCAGGTAGGGTTACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCAGCCTCCGGGCGGTCCGAGTTGTAATTTGAAGAGGATGCTTTTGGCGAGGCGCCTTCCGAGTGCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTTGGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAACCCCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTTGTGCCCGTCGAATCAGCCGCCGCTCGTCGGCGGCGCACTTCGGCGGGCTCAGGCCAGCATCAGTTCGCTGCAGGGGGAGAAAGGCGGTGGGAATGTGGCTCTTCGGAGTGTTATAGCCCGCCGCGCAATACCCCTCGGCGGACTGAGGACCGCGCATCTGCAAGGATGCTGGCGTAATGGTCGTCAGCGA

Morphology On Emmons’modification of Sabouraud’s medium at 25°C after 3 days, mycelium white to dingy white becoming pale gray, velutinous, slightly raised. Reverse tan. Hyphae hyaline, guttulate. Conidia subhyaline, elongated ellipsoidal to broadly ovoid, smooth, contain oil dropplets, 8.25-10.5 X 3.75-6 µm.
Name of Depositor A Bakerspigel
Isolation
Sputum and lung tissue, Canada
Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation