Trichophyton rubrum (Castellani) Sabouraud (ATCC® 28191)

Strain Designations: 689  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Trichophyton rubrum (Castellani) Sabouraud, anamorph
Strain Designations 689
Application
Biomedical Research and Development Material
Biosafety Level 2
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Morphology Colonies on Emmons' modification of Sabouraud's agar at 25°C fluffy to cottony, white becoming rose when ageing; reverse wine-red to olive. Microconidia peg-shaped to pyriform, sessile alongside undifferentiated hyphae.
Medium Medium 28: Emmons' modification of Sabouraud's agar
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TCCGTAGGTGAACCTGCGGAAGGATCATTAACGCGCAGGCCGGAGGCTGGCCCCCCACGATAGGGACCGACGTTCCATCAGGGGTGAGCAGACGTGCGCCGGCCGTACGCCCCCATTCTTGTCTACCTCACCCGGTTGCCTCGGCGGGCCGCGCTCCCCCTGCCAGGGAGAGCCGTCCGGCGGGCCCCTTCTGGGAGCCTCGAGCCGGACCGCGCCCGCCGGAGGACAGACACCAAGAAAAAATTCTCTGAAGAGCTGTCAGTCTGAGCGTTTAGCAAGCACAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCCCCTCCCTTCGGGGGCGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTCCTAGGCGAATGGGCAGCCAATTCAGCGCCCTCAGGACCGGCCGCCCTGGCCCCAATCTTTATATATATATATATCTTTTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCTCCCCCGGGGGTCCGAGTTGTAATTTGCAGAGGATGCTTCGGGCGCGGCCCCCGTCTAAGTTCCTTGGAACAGGACGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGGCGGCCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATACCGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTCGGGGGGCGGGGTTCAGCGGGCGCTCGTCGCCCGTGCACTGCCCGCTCCCCGGGCCAGCATCAGCTTCGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGTCTCTAGGGACGTCTTATAGCCGGGGGTGCAATGCGGCCCGTCGAGACTGAGGAACGCGCTCCGGCTCGGATGCTGGCGTAATGGCCGTAAGCGGC

Morphology Colonies on Emmons' modification of Sabouraud's agar at 25°C fluffy to cottony, white becoming rose when ageing; reverse wine-red to olive. Microconidia peg-shaped to pyriform, sessile alongside undifferentiated hyphae.
Name of Depositor MA Gordon
References

Salkin IF. Dermatophyte test medium: evaluation with nondermatophytic pathogens. Appl. Microbiol. 26: 134-137, 1973. PubMed: 4795526

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation