Trichophyton rubrum (Castellani) Sabouraud (ATCC® 28191)

Strain Designations: 689  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Trichophyton rubrum (Castellani) Sabouraud, anamorph
Strain Designations 689
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety  classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Morphology Colonies on Emmons' modification of Sabouraud's agar at 25°C fluffy to cottony, white becoming rose when ageing; reverse wine-red to olive. Microconidia peg-shaped to pyriform, sessile alongside undifferentiated hyphae.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TCCGTAGGTGAACCTGCGGAAGGATCATTAACGCGCAGGCCGGAGGCTGGCCCCCCACGATAGGGACCGACGTTCCATCAGGGGTGAGCAGACGTGCGCCGGCCGTACGCCCCCATTCTTGTCTACCTCACCCGGTTGCCTCGGCGGGCCGCGCTCCCCCTGCCAGGGAGAGCCGTCCGGCGGGCCCCTTCTGGGAGCCTCGAGCCGGACCGCGCCCGCCGGAGGACAGACACCAAGAAAAAATTCTCTGAAGAGCTGTCAGTCTGAGCGTTTAGCAAGCACAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCCCCTCCCTTCGGGGGCGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTCCTAGGCGAATGGGCAGCCAATTCAGCGCCCTCAGGACCGGCCGCCCTGGCCCCAATCTTTATATATATATATATCTTTTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCTCCCCCGGGGGTCCGAGTTGTAATTTGCAGAGGATGCTTCGGGCGCGGCCCCCGTCTAAGTTCCTTGGAACAGGACGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGGCGGCCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATACCGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTCGGGGGGCGGGGTTCAGCGGGCGCTCGTCGCCCGTGCACTGCCCGCTCCCCGGGCCAGCATCAGCTTCGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGTCTCTAGGGACGTCTTATAGCCGGGGGTGCAATGCGGCCCGTCGAGACTGAGGAACGCGCTCCGGCTCGGATGCTGGCGTAATGGCCGTAAGCGGC

Morphology Colonies on Emmons' modification of Sabouraud's agar at 25°C fluffy to cottony, white becoming rose when ageing; reverse wine-red to olive. Microconidia peg-shaped to pyriform, sessile alongside undifferentiated hyphae.
Name of Depositor MA Gordon
References

Salkin IF. Dermatophyte test medium: evaluation with nondermatophytic pathogens. Appl. Microbiol. 26: 134-137, 1973. PubMed: 4795526

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation