Trichophyton mentagrophytes (Robin) Blanchard (ATCC® 28185)

Alternate State: Arthroderma benhamiae Ajello et Cheng, teleomorph, Arthroderma vanbreuseghemii Takashio, teleomorph  /  Strain Designations: 360-A [M1804]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Trichophyton mentagrophytes (Robin) Blanchard, anamorph
Strain Designations 360-A [M1804]
Synonym Trichophyton interdigitale
Alternate State Arthroderma benhamiae Ajello et Cheng, teleomorph, Arthroderma vanbreuseghemii Takashio, teleomorph
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety  classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Morphology After 6 days on Emmons’ modification of Sabouraud’s agar at 25°C, colony is white, flat, powdery, reverse is pale yellow. Microconidia abundant, hyaline, subglobose or teardrop-shaped, formed alongside the hyphae. Macroconidia are hyaline, thin-walled, cigar-shaped, 4-septate.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence.

AGGATCATTAACGCGCAGGCCGGAGGCTGGCCCCCCACGATAGGGCCAAACGTCCGTCAGGGGTGAGCAGATGTGCGCCGGCCGTACCGCCCCATTCTTGTCTACATTACTCGGTTGCCTCGGCGGGCCGCGCTCTCCCAGGAGAGCCGTTCGGCGAGCCTCTCTTTAGTGGCTAAACGCTGGACCGCGCCCGCCGGAGGACAGACGCAAAAAAATTCTTTCAGAAGAGCTGTCAGTCTGAGCGTTAGCAAGCAAAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAGCCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCGCCCCCGTCTTTGGGGGTGCGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTCCTAGGCGAATGGGCAACAAACCAGCGCCTCCAGGACCGGCCGCCCTGGCCTCAAAATCTGTTTTATACTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG

Morphology After 6 days on Emmons’ modification of Sabouraud’s agar at 25°C, colony is white, flat, powdery, reverse is pale yellow. Microconidia abundant, hyaline, subglobose or teardrop-shaped, formed alongside the hyphae. Macroconidia are hyaline, thin-walled, cigar-shaped, 4-septate.
Name of Depositor MA Gordon
References

Salkin IF. Dermatophyte test medium: evaluation with nondermatophytic pathogens. Appl. Microbiol. 26: 134-137, 1973. PubMed: 4795526

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation