Trichophyton mentagrophytes (Robin) Blanchard, anamorph (ATCC® 28185)

Alternate State: Arthroderma benhamiae Ajello et Cheng, teleomorph, Arthroderma vanbreuseghemii Takashio, teleomorph  /  Strain Designations: 360-A [M1804]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations 360-A [M1804]
Synonym Trichophyton interdigitale
Alternate State Arthroderma benhamiae Ajello et Cheng, teleomorph, Arthroderma vanbreuseghemii Takashio, teleomorph
Application
Biomedical Research and Development Material
Biosafety Level 2
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Morphology After 6 days on Emmons’ modification of Sabouraud’s agar at 25°C, colony is white, flat, powdery, reverse is pale yellow. Microconidia abundant, hyaline, subglobose or teardrop-shaped, formed alongside the hyphae. Macroconidia are hyaline, thin-walled, cigar-shaped, 4-septate.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence.

AGGATCATTAACGCGCAGGCCGGAGGCTGGCCCCCCACGATAGGGCCAAACGTCCGTCAGGGGTGAGCAGATGTGCGCCGGCCGTACCGCCCCATTCTTGTCTACATTACTCGGTTGCCTCGGCGGGCCGCGCTCTCCCAGGAGAGCCGTTCGGCGAGCCTCTCTTTAGTGGCTAAACGCTGGACCGCGCCCGCCGGAGGACAGACGCAAAAAAATTCTTTCAGAAGAGCTGTCAGTCTGAGCGTTAGCAAGCAAAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAGCCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCGCCCCCGTCTTTGGGGGTGCGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTCCTAGGCGAATGGGCAACAAACCAGCGCCTCCAGGACCGGCCGCCCTGGCCTCAAAATCTGTTTTATACTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG

Morphology After 6 days on Emmons’ modification of Sabouraud’s agar at 25°C, colony is white, flat, powdery, reverse is pale yellow. Microconidia abundant, hyaline, subglobose or teardrop-shaped, formed alongside the hyphae. Macroconidia are hyaline, thin-walled, cigar-shaped, 4-septate.
Name of Depositor MA Gordon
References

Salkin IF. Dermatophyte test medium: evaluation with nondermatophytic pathogens. Appl. Microbiol. 26: 134-137, 1973. PubMed: 4795526

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation