Phialophora verrucosa Medlar, anamorph (ATCC® 28182)

Strain Designations: 303 [45229]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations 303 [45229]
Application
Biomedical Research and Development Material
Biosafety Level 2
Product Format freeze-dried
Type Strain no
Preceptrol® no
Medium Medium 307: Cornmeal agar
Growth Conditions
Temperature: 25.0°C
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TGCGGAAGGATCATTAACGAGTTAGGGTCTCTCCAGGCCCGACCTCCCAACCCTTTGTCTACCTTGCTGCATGTTGCTTTGGCGGACCCGTCTCACGACCGCCCTGGGACCGCCGAGAGGCGTCCCTAGGCCCGTGTCCGCCGATAGCCAACCTAAACTCTTGGATGAATCGTGTTTTATGTCTGAGTCTTGTGATTAAATCAAAAGCAAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTATCACCCCTCAAGCCCCGTGCTTGGTGTTGGACGGATCTTGGTCGTGTGATCGCGACCCCTCCTAAAGACAATGACGGCGGCCTGTGGATCCCCCGGTACACTGAGCTTTTAACTGAGCACGTATCGGACAAGGGCGCCCAGGACCCGGTCCTTCTCCTTTAACCAGGAAATTTCTTCAAGGTTGACCTCGGATCAGGTAGGAATACGCGCTGAACTTAAGCATATCAATA

Name of Depositor MA Gordon
References

Salkin IF. Dermatophyte test medium: evaluation with nondermatophytic pathogens. Appl. Microbiol. 26: 134-137, 1973. PubMed: 4795526

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation