Sporothrix schenckii Hektoen et Perkins, anamorph (ATCC® 26327)

Strain Designations: 180 (C 25)  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations 180 (C 25)
Application
Biomedical Research and Development Material
Biosafety Level 2
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Experimental sporotrichosis
Creatine and creatinine assimilation
Guanidoacetic acid assimilation
Morphology Colonies on Emerson YpSs Agar at 25°C after 4-5 days growing rapidly, wrinkled, lanose and white. Conidia tear-shaped to clavate.
Medium ATCC® Medium 350: Emerson YpSs agar
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

CCCTCCGCCCCCCGCCCGCCAGGGGCGGCGGGCCCTACGAACCTTTGTATCTCAACCACTAGAAAACCGTCTGAGGAAAAAACAAAATAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGCGAACCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCCCCCCCTCACGCGCCCCGTTGCGCGCTGGTGTTGGGGCGCCCTCCGCCTGGCGGGGGGCCCCCGAAAGCGAGTGGCGGGCCCTGTGGATGGCTCCGAGCGCAGTACCGAACGCATGTTCTCCCCTCGCTCCGGACGCCCCCCAGGCGCCCTGCCGTGAAAACGCGCATGACGCGCAGCTCTTTTTACAAGGTTGACCTCGGATCAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCCGGCCCGAGTTGTAATTTGGAGAGGATGCTTCTGGCGCGGCGCCGTCCGAGTTCCTTGGAACAGGACGCCACAGAGGGTGAGAGCCCCGTACGGACGGACGCCTAGCCTCTACGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTGTGACCAGACTTGCGCCCCGCGGACCACCCGGCGTTCTCGCCGGTGCACTCTGCGGTGCGCAGGCCAGCATCGGTTCTCCCAGGGGGACAAAGGCCGCGGGAACGTAGCTCCTTCGGGAGTGTTATAGCCCGCGGCGGCATGCCCCTGGGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCACCAGCGAC

Morphology Colonies on Emerson YpSs Agar at 25°C after 4-5 days growing rapidly, wrinkled, lanose and white. Conidia tear-shaped to clavate.
Name of Depositor F Staib
Chain of Custody
ATCC <-- F Staib <-- D Howard
Isolation
Human, California
References

Staib F, et al. Creatine and creatinine assimilation by Sporothrix schenckii. Zentralbl. Bakteriol., I Abt., Orig. A221: 94-99, 1972.

Staib F, et al. Observations on experimental sporotrichosis of the muscle. Zentralbl. Bakteriol., I Abt., Orig. A221: 250-256, 1972.

Staib F, et al. Assimilation of guanidoacetic acid by Sporothrix schenckii. Zentralbl. Bakteriol., I Abt., Orig. A224: 237-240, 1973.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation