Sporothrix schenckii Hektoen et Perkins, anamorph (ATCC® 26327)

Strain Designations: 180 (C 25)  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations 180 (C 25)
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety  classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Experimental sporotrichosis
Creatine and creatinine assimilation
Guanidoacetic acid assimilation
Morphology Colonies on Emerson YpSs Agar at 25°C after 4-5 days growing rapidly, wrinkled, lanose and white. Conidia tear-shaped to clavate.
Medium ATCC® Medium 350: Emerson YpSs agar
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

CCCTCCGCCCCCCGCCCGCCAGGGGCGGCGGGCCCTACGAACCTTTGTATCTCAACCACTAGAAAACCGTCTGAGGAAAAAACAAAATAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGCGAACCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCCCCCCCTCACGCGCCCCGTTGCGCGCTGGTGTTGGGGCGCCCTCCGCCTGGCGGGGGGCCCCCGAAAGCGAGTGGCGGGCCCTGTGGATGGCTCCGAGCGCAGTACCGAACGCATGTTCTCCCCTCGCTCCGGACGCCCCCCAGGCGCCCTGCCGTGAAAACGCGCATGACGCGCAGCTCTTTTTACAAGGTTGACCTCGGATCAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCCGGCCCGAGTTGTAATTTGGAGAGGATGCTTCTGGCGCGGCGCCGTCCGAGTTCCTTGGAACAGGACGCCACAGAGGGTGAGAGCCCCGTACGGACGGACGCCTAGCCTCTACGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTGTGACCAGACTTGCGCCCCGCGGACCACCCGGCGTTCTCGCCGGTGCACTCTGCGGTGCGCAGGCCAGCATCGGTTCTCCCAGGGGGACAAAGGCCGCGGGAACGTAGCTCCTTCGGGAGTGTTATAGCCCGCGGCGGCATGCCCCTGGGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCACCAGCGAC

Morphology Colonies on Emerson YpSs Agar at 25°C after 4-5 days growing rapidly, wrinkled, lanose and white. Conidia tear-shaped to clavate.
Name of Depositor F Staib
Chain of Custody
ATCC <-- F Staib <-- D Howard
Isolation
Human, California
References

Staib F, et al. Creatine and creatinine assimilation by Sporothrix schenckii. Zentralbl. Bakteriol., I Abt., Orig. A221: 94-99, 1972.

Staib F, et al. Observations on experimental sporotrichosis of the muscle. Zentralbl. Bakteriol., I Abt., Orig. A221: 250-256, 1972.

Staib F, et al. Assimilation of guanidoacetic acid by Sporothrix schenckii. Zentralbl. Bakteriol., I Abt., Orig. A224: 237-240, 1973.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation