Arthroderma vanbreuseghemii Takashio, teleomorph (ATCC® 24953)

Alternate State: Trichophyton mentagrophytes (Robin) Blanchard, anamorph, Trichophyton mentagrophytes var. interdigitale (Priestley) Georg, anamorph  /  Strain Designations: RV 24720  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Trichophyton mentagrophytes (Robin) Blanchard, anamorph
Strain Designations RV 24720
Alternate State Trichophyton mentagrophytes (Robin) Blanchard, anamorph, Trichophyton mentagrophytes var. interdigitale (Priestley) Georg, anamorph
Application
Biomedical Research and Development Material
Biosafety Level 2
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Mating Type mating type plus
Comments
taxonomy
Mating experiments with Arthroderma benhamiae
Morphology After 10 days at 25°C colonies thin, floccose, white. Conidia rare, spherical to tear-shaped. Small nodular clumps of cells, surrounded by yellowish exudate, frequently present, particularly in non-sporulating strains
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

ACGCGCAGGCCGGAGGCTGGCCCCCCACGATAGGGCCAAACGTCCGTCAGGGGTGAGCAGATGTGCGCCGGCCGTACCGCCCCATTCTTGTCTACTTACTCGGTTGCCTCGGCGGGCCGCGCTCTCCCAGGAGAGCCGTTCGGCGAGCCTCTCTTTAGTGGCTAAACGCTGGACCGCGCCCGCCGGAGGACAGACGCAAAAAAATTCTTTCAGAAGAGCTGTAGTCTGAGCGTTAGCAAGCAAAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAGCCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCGCCCCCGTCTTTGGGGGTGCGGGAGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTCCTAGGCGAATGGGCAACAAACCAGCGCCTCCAGGACCGGCCGCCCTGGCCTCAAAATCTGTTTTATACTTATCAGGTTGACCTCGGATCAGGTAG

Morphology After 10 days at 25°C colonies thin, floccose, white. Conidia rare, spherical to tear-shaped. Small nodular clumps of cells, surrounded by yellowish exudate, frequently present, particularly in non-sporulating strains
Name of Depositor R Vanbreuseghem
Chain of Custody
ATCC <-- R Vanbreuseghem <-- Dr. Campos-Magalhaes
Isolation
Human, Mozambique
References

Takashio M. Is Arthroderma benhamiae the perfect state of Trichophyton mentagrophytes?. Sabouraudia 10: 122-127, 1972. PubMed: 5043957

. . Ann. Soc. Belge Med. Trop. 53: 427-580, 1973.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation