Aspergillus fumigatus Fresenius, anamorph (ATCC® 208997)

Strain Designations: W27023  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations W27023
Application
Biomedical Research and Development Material
Emerging infectious disease research
Biosafety Level 2
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Morphology After 2 weeks at 25°C colonies appressed with white mycelium turning green with the formation of conidia.  Conidia grayish to olive green, globose to broadly ovoid, smoothly to finely roughened. Conidial heads predominantly columnar; stipes uncolored, smooth-walled. 
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

CCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTCTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGGGAGGCCTTGCGCCCCCGGGCCCGCGCCCGCCGAAGACCCCAACATGAACGCTGTTCTGAAAGTATGCAGTCTGAGTTGATTATCGTAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCCGTCCCCCTCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCTGCTCTGTAGGCCCGGCCGGCGCCAGCCGACACCCAACTTTATTTTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG

Morphology After 2 weeks at 25°C colonies appressed with white mycelium turning green with the formation of conidia.  Conidia grayish to olive green, globose to broadly ovoid, smoothly to finely roughened. Conidial heads predominantly columnar; stipes uncolored, smooth-walled. 
Name of Depositor EK Manavathu
Special Collection NCRR Contract
Chain of Custody
ATCC <-- EK Manavathu <-- W Brown
Isolation
human clinical isolate, Detroit, MI
Cross References

Nucleotide (GenBank) : KC689332 ITS including 5.8S rRNA gene

References

Manavathu EK, et al. Comparative study of susceptibilities of germinated and ungerminated conidia of Aspergillus fumigatus to various antifungal agents. J. Clin. Microbiol. 37: 858-861, 1999. PubMed: 9986876

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation