Penicillium marneffei Segretain et al., anamorph (ATCC® 201564)

Strain Designations: SB0501  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations SB0501
Application
Biomedical Research and Development Material
Emerging infectious disease research
Biosafety Level 2
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
DNA type II by restriction endonuclease analysis
Morphology Colonies dense on Potato dextrose agar at 25°C after 4-5 days mycelium white, produces red soluble pigment and dark red reverse with greenish-grey sporulating areas. Phialides ampulliform. Conidia globose and smooth walled.
Medium Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGCCCTCGCGGCCCAACCTCCCACCCTTGTCTCTATACACCTGTTGCTTTGGCGGGCCCACCGGGGCCACCCGGTCGCCGGGGGACGTTTGTCCCCGGGCCCGCGCCCGCCGAAGCGCCCTGTGAACCCTGATGAAGATGGACTGTCTGAGTACCATGAAAATTGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGTGTGGTCCCTCCGGGGACCTGCCCGAAAGGCAGCGGCGACGTCCGTCTGGTCCTCGAGCGTATGGGGCTCTGTCACTCGCTCGGGAAGGACCTGCGGGGGTTGGTCACCACCATATTTACCACGGTTGACCTCGGATCAGGTAGGAGTTACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCCCTTTGGGGTCCGAGTTGTAATTTGCAGAGGATGCTTCGGGTGCGGTCCCCATCTAAGTGCCCTGGAACGGGCCGTCATAGAGGGTGAGAATCCCGTCTGGGATGGGCGGCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGTTGTCCACCAGACTCGCCCGGGGGGGCTCAGCCGGCACGTGTGCCGGTGTACTCCTCTCCGGGCGGGCCAGCATCGGTTTGGGCGGCTGGTGAAAGGCCCCGGGAATGTAACACCCTCCGGGGTGCCTTATAGCCCGGGGTGCCATGCAGCCAGCCTGGACCGAGGCCCGCGCTTCGGCGAGGATGCTGGCGTAATGGTGGTCAACGGC

Morphology Colonies dense on Potato dextrose agar at 25°C after 4-5 days mycelium white, produces red soluble pigment and dark red reverse with greenish-grey sporulating areas. Phialides ampulliform. Conidia globose and smooth walled.
Name of Depositor N Vanittanakom
Special Collection NCRR Contract
Isolation
Soil from a burrow of bamboo rat, Rhizomys sumatrensis, Chiang Mai, Thailand
References

Vanittanakom N, et al. Restriction endonuclease analysis of Penicillium marneffei. J. Clin. Microbiol. 34: 1834-1836, 1996. PubMed: 8784605

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation