Exophiala dermatitidis (Kano) de Hoog, anamorph (ATCC® 201306)

Strain Designations: BMU 3271  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations BMU 3271
Application
Biomedical Research and Development Material
Biosafety Level 2
Product Format frozen
Type Strain no
Preceptrol® no
Medium ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24.0°C
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TGCGGAGGGATCATTAACGAGTTAGGGTCTTCTCAGGCCCGACCTCCCAACCCTTTGTTTACCCGACCCATGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGAGGACCGCCTATTCAGGTCCTCTGGCCCGCGCCCGCCGGTAGCCAATTCTACCAAACTCTTGAATCAAATCGTGTCCAATGTCTGAGTATATTACAAAATAAAAGCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTATCACCCCTCAAGCCCCCCGGCTTGGTGTTGGACGGTCTGGTCGAGCGTTTCCGCGCGACCCCTCCCAAAGACAATGACGGCGGCCTGGTTGGACCCCCGGTACACGGAGCTTCTTCACTGAGCACGTATCGGTTTCAAGGTGTCCCCGGGACCCGGTCGACCTCTCTTGCTCCCCTGCGGGAGTGGGAGAGAACCCCCCTTTTTATCAAGGTTGACCTCGGATC

Name of Depositor R Li
Special Collection NCRR Contract
Chain of Custody
ATCC <<--R Li<<--Y.N. Li
Isolation
human skin, Zhanjiang, China
References

Ruo-Yu Li, personal communication

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation