Fonsecaea pedrosoi (Brumpt) Negroni (ATCC® 18658)

Strain Designations: CBS 271.37 [IMI 134458]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Rhinocladiella pedrosoi (Brumpt) Schol-Schwarz
Strain Designations CBS 271.37 [IMI 134458]
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety  classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Comments Genome sequencing strain (Broad Institute, USA)
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TGCTTTGAATGCTAGTCAGTCTCGAACTGGCGACACTGCCAAATTGCGGGGACACCCTAAAGACCTTGACACCAAGCACCATCGGAAACGGTGGTGTGGCCGAGCTAATTGCCCTGGGTATGGTAATAGTTCAAGGTATGAGACTCCCTCCGCCAGGGGGGAAAAGAAGTCGAAATGGGCAATCCGCAGCCAAGTCCTACAGCCTTCCTCTTGCCGGGGAGGCCACGGACGCTGTTCACAGGCCAAATGGTAGTGGGTGAACCTATTAGGTTCGCTTAAGATATGGTCGGTCTCTGGGCGAAAGCCCAGGGGTAAGTTTCACTGAAACCCTCCACAAACGTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAGTTAGGGTCTCCTAGGCCCGACCTCCCAACCCTTTGCTTACTAGACCTCAGTTGCTTCGGCAGGCCCGTCTTAATCTGACCGCTGGAGGACCGCCTAATGCGGGTGTTACCTCTGGCCAGTGTCTGCCGATAGCCTAATCTCCTAACTCTGGATCAATCATGATTTACAATGTCTAAGTGATTTTATTCAATTAAAAGCAAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTATCACCCCCTCAAGCCCCTGTGCTTGGTGTTGGACGGCTTGGTGGAGCGAGTTCACACTTTCCACCCCTCCTAAAGACAATGACGGCGGCCTGCGGAACCCCCGGTACACTGAGCTTCTTTATTGAGCACGTATCGGATGAAGGGTGCCCGGGACCCGGTCTTCTCCCTCACGGGAACACTTTTTTTTTTAAGGTTGACCTCGGATCAGGTAGGAATACGCGCTGAACTTAAGCATATCAATAA

Name of Depositor CBS
Chain of Custody
ATCC <-- CBS <-- P. Negroni
Isolation
Human, South America
Cross References

Nucleotide (GenBank) : L36997 Fonsecaea pedrosoi small subunit ribosomal RNA (rRNA).

References

Yamagishi Y, et al. Mitochondrial DNA analysis of Phialophora verrucosa. Mycoses 40: 329-334, 1997. PubMed: 9470416

Najafzadeh MJ, et al. Fonsecaea nubica sp. nov, a new agent of human chromoblastomycosis revealed using molecular data. Med. Mycol. 48: 800-806, 2010. PubMed: 20302550

Najafzadeh MJ, et al. Genetic diversity and species delimitation in the opportunistic genus Fonsecaea. Med. Mycol. 47: 17-25, 2009. PubMed: 19107635

De Hoog GS, et al. Molecular ecology and pathogenic potential of Fonsecaea species. Med. Mycol. 42: 405-416, 2004. PubMed: 15552642

Lutzoni F, Pagel M, Reeb V. Major fungal lineages are derived from lichen symbiotic ancestors. Nature 411: 937-940, 2001. PubMed: 11418855

Untereiner WA, Naveau FA. Molecular systematics of the Herpotrichiellaceae with an assessment of the phylogenetic positions of Exophiala dermatitidis and Phialophora americana. Mycologia 91: 67-83, 1999.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation