Aspergillus fumigatus Fresenius, anamorph (ATCC® 16424)

Strain Designations: NRC A-4-56 (WB 5122)  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations NRC A-4-56 (WB 5122)
Application
Biomedical Research and Development Material
Emerging infectious disease research
Biosafety Level 2

Biosafety  classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
penetrates hydrophilic contact lenses
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTCTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGGGAGGCCTTGCGCCCCCGGGCCCGCGCCCGCCGAAGACCCCAACATGAACGCTGTTCTGAAAGTATGCAGTCTGAGTTGATTATCGTAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCCGTCCCCCTCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCTGCTCTGTAGGCCCGGCCGGCGCCAGCCGACACCCAACTTTATTTTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG

Name of Depositor SM Martin
Chain of Custody
ATCC <-- SM Martin <-- F Blank
Isolation
human lung with aspergillosis, Pennsylvania
Cross References

Nucleotide (GenBank) : KC689315 ITS including 5.8S rRNA gene

References

Filppi JA, et al. Penetration of hydrophilic contact lenses by Aspergillus fumagatus. Am. J. Optom. Arch. Am. Acad. Optom. 50: 553-557, 1973. PubMed: 4592551

Wood RL, et al. Characterization and optimization of in vitro assay conditions for (1,3)beta-glucan synthase activity from Aspergillus fumigatus and Candida albicans for enzyme inhibition screening. J. Antibiot. 51: 665-675, 1998. PubMed: 9727393

Jonsson AG, Martin SM. Protease production by Aspergillus fumigatus. Agric. Biol. Chem. 28: 734-739, 1964.

Martin SM, Jonsson AG. An extracellular protease from Aspergillus fumigatus. Can. J. Biochem. 43: 1745-1753, 1965. PubMed: 5864487

Nakata M, et al. A novel assay for fungal ketol-isomerase activity. J. Antibiot. 54: 737-743, 2001. PubMed: 11714230

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation