Aspergillus fumigatus Fresenius, anamorph (ATCC® 16424)

Strain Designations: NRC A-4-56 (WB 5122)  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations NRC A-4-56 (WB 5122)
Application
Biomedical Research and Development Material
Emerging infectious disease research
Biosafety Level 2
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
penetrates hydrophilic contact lenses
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTCTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGGGAGGCCTTGCGCCCCCGGGCCCGCGCCCGCCGAAGACCCCAACATGAACGCTGTTCTGAAAGTATGCAGTCTGAGTTGATTATCGTAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCCGTCCCCCTCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCTGCTCTGTAGGCCCGGCCGGCGCCAGCCGACACCCAACTTTATTTTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG

Name of Depositor SM Martin
Chain of Custody
ATCC <-- SM Martin <-- F Blank
Isolation
human lung with aspergillosis, Pennsylvania
Cross References

Nucleotide (GenBank) : KC689315 ITS including 5.8S rRNA gene

References

Filppi JA, et al. Penetration of hydrophilic contact lenses by Aspergillus fumagatus. Am. J. Optom. Arch. Am. Acad. Optom. 50: 553-557, 1973. PubMed: 4592551

Wood RL, et al. Characterization and optimization of in vitro assay conditions for (1,3)beta-glucan synthase activity from Aspergillus fumigatus and Candida albicans for enzyme inhibition screening. J. Antibiot. 51: 665-675, 1998. PubMed: 9727393

Jonsson AG, Martin SM. Protease production by Aspergillus fumigatus. Agric. Biol. Chem. 28: 734-739, 1964.

Martin SM, Jonsson AG. An extracellular protease from Aspergillus fumigatus. Can. J. Biochem. 43: 1745-1753, 1965. PubMed: 5864487

Nakata M, et al. A novel assay for fungal ketol-isomerase activity. J. Antibiot. 54: 737-743, 2001. PubMed: 11714230

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation