Cryptococcus gattii (Vanbreus. et Takashio) Kwon-Chung et Boekhout, anamorph (ATCC® 14248)

Alternate State: Filobasidiella bacillispora Kwon-Chung, teleomorph  /  Strain Designations: 110 [CBS 883]  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Cryptococcus neoformans
Strain Designations 110 [CBS 883]
Alternate State Filobasidiella bacillispora Kwon-Chung, teleomorph
Application
Biomedical Research and Development Material
Emerging infectious disease research
Biosafety Level 2
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes (of Cryptococcus hondurianus)
Preceptrol® no
Morphology On Emmon’s Modification of Sabourauds’ medium at 25°C after 21 days, colonies creamy buff to tan, mucoid, smooth, slightly raised, margin entire. Cells globose, hyaline, smooth, contain oil drops, 3.75-8.25 X 3.75-7.5 µm. Pseudohyphae not observed.
Medium Medium 28: Emmons' modification of Sabouraud's agar
Medium 200: YM agar or YM broth
Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCAGTAGAGAATGCTGGGCTTCGGTCCATTTATCTACCCATCTACACCTGTGAACTGTTTATGTGCTTCGGCACGTTTTACACAAACTTCTAAATGTAATGAATGTAATCTTATTATAACAATAATAAAACTTTCAACAACGGATCTCTTGGCTTCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGAGTCATGAAAATCTCAATCCCTCGGGTTTTATTACCTGTTGGACTTGGATTTGGGTGTTTGCCGCGACCTGCAAAGGACGTCGGCTCGCCTTAAATGTGTTAGTGGGAAGGTGATTACCTGTCAGCCCGGCGTAATAAGTTTCGCTGGGCCTATGGGGTAGTCTTCGGCTTGCTGATAACAACCATCTCTTTTTTGTTTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTTAGTAACGGCGAGTGAACCGGGAAGAGCTCAAATTTGAAATCTGGCGTCCTCCGGGCGTCCGAGTTGTAATCTACAGAAACGTTTTCCGTGCTGGACCGTGTCTAAGTCCCTTGGAATAGGGTATCAAAGAGGGTGACAATCCCGTACTTGACACGATCACCAGTGCTCTGTGATACGTTTTCTACGAGTCGCGTTACTTGGGAGTGTAGCGCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGTGGAAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTCTATTGGGTTCAGCCAGCTCTGCTGGTGTATTCCCTTTAGACGGGTCAACATCAGTTCTGATCGGTGGATAAGGGCTGGAGGAATGTGGCACTCTTCGGGGTGTGTTATAGCCTCCTGTCGCATACACTGGTTGGGACTGAGGAATGCAGCTCGCCTTTATGGCCGGGGTTCGCCCACGTTCGAGCTTAGGATGTTGACAAAATGGCTTTAAACGA

Morphology On Emmon’s Modification of Sabourauds’ medium at 25°C after 21 days, colonies creamy buff to tan, mucoid, smooth, slightly raised, margin entire. Cells globose, hyaline, smooth, contain oil drops, 3.75-8.25 X 3.75-7.5 µm. Pseudohyphae not observed.
Name of Depositor A Castellani
Isolation
Skin of patient with blastomycosis
References

Castellani AJ. Blastomycosis: a short general account. Med. Press Cir. 136: 438-443, 1933.

Kwon-Chung KJ, et al. (1557) Proposal to conserve the name Cryptococcus gattii against C. hondurianus and C. basillisporus (Basidiomycota, Hymenomycetes, Tremello-mycetidae) Taxon 51: 804-806, 2002.

of Cryptococcus hondurianus

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation