Microsporum gypseum (Bodin) Guiart et Grigorakis, anamorph (ATCC® 13994)

Alternate State: Arthroderma gypseum (Nannizzi) Weitzman et al., teleomorph, Arthroderma incurvatum (Stockdale) Weitzman et al., teleomorph  /  Strain Designations: 256  /  Product Format: freeze-dried

Strain Designations 256
Alternate State Arthroderma gypseum (Nannizzi) Weitzman et al., teleomorph, Arthroderma incurvatum (Stockdale) Weitzman et al., teleomorph
Application
Biomedical Research and Development Material
Biosafety Level 2
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Medium Medium 28: Emmons' modification of Sabouraud's agar
Medium 200: YM agar or YM broth
Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGCGCAGGCCGTAGACGGCCCGTCCCCGGATGCGTCCGGGGGCGGTGTCGCCGGCCACACGCCCATTCTTGTCTATTTACCCAGTTGCCTCGGCGGGCCGCGCACTCGTGCCGCGCCTCGAGGAGCCGTCCGGGGACAATCAACTCCCTGGATCGCGCCCGCCGGAGGAGTGATTAAAATCCATGAATACTGTTCCGTCTGAGCGTTAGCAAGTAAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCCGCCCTCCCTACTCCAGGGGAGGGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTCCTGGGCGAATGGGCAACAAACCAACGCCTCTAGGACCGGCCGGTTTTCTGGCCTAGTTTTAGTTAGGGATGAACTTCCCTACAATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCCTCCTACGGGGGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGGTGTGGCCGCCGTCTAAGTTCCTTGGAACAGGACGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGCCGGTCCGCGCCCGTGTGAAGCTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATACTGGTCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTCGGGGGCGGGGTTCAGCGGGTGCTCGTCGCCCGTGCACTCCCCGTCTCCCGGGCCAGCATCAGTTTCGACGGCCGGTCAAAGGCCTCCGGAATGTGTCGTCTCTCGGGACGTCTTATAGCCGGGGGTGCAATGCGGCCCGTCGGGACTGAGGAACGCGCTTCGGCTCGGATGCTGGCGTAATGGCCGTAAGCGGC

Name of Depositor CW Emmons
Isolation
Scalp lesion