Microsporum gypseum (Bodin) Guiart et Grigorakis, anamorph (ATCC® 13994)

Alternate State: Arthroderma gypseum (Nannizzi) Weitzman et al., teleomorph, Arthroderma incurvatum (Stockdale) Weitzman et al., teleomorph  /  Strain Designations: 256  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations 256
Alternate State Arthroderma gypseum (Nannizzi) Weitzman et al., teleomorph, Arthroderma incurvatum (Stockdale) Weitzman et al., teleomorph
Application
Biomedical Research and Development Material
Biosafety Level 2
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Medium Medium 28: Emmons' modification of Sabouraud's agar
Medium 200: YM agar or YM broth
Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGCGCAGGCCGTAGACGGCCCGTCCCCGGATGCGTCCGGGGGCGGTGTCGCCGGCCACACGCCCATTCTTGTCTATTTACCCAGTTGCCTCGGCGGGCCGCGCACTCGTGCCGCGCCTCGAGGAGCCGTCCGGGGACAATCAACTCCCTGGATCGCGCCCGCCGGAGGAGTGATTAAAATCCATGAATACTGTTCCGTCTGAGCGTTAGCAAGTAAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCCGCCCTCCCTACTCCAGGGGAGGGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTCCTGGGCGAATGGGCAACAAACCAACGCCTCTAGGACCGGCCGGTTTTCTGGCCTAGTTTTAGTTAGGGATGAACTTCCCTACAATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCCTCCTACGGGGGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGGTGTGGCCGCCGTCTAAGTTCCTTGGAACAGGACGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGCCGGTCCGCGCCCGTGTGAAGCTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATACTGGTCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTCGGGGGCGGGGTTCAGCGGGTGCTCGTCGCCCGTGCACTCCCCGTCTCCCGGGCCAGCATCAGTTTCGACGGCCGGTCAAAGGCCTCCGGAATGTGTCGTCTCTCGGGACGTCTTATAGCCGGGGGTGCAATGCGGCCCGTCGGGACTGAGGAACGCGCTTCGGCTCGGATGCTGGCGTAATGGCCGTAAGCGGC

Name of Depositor CW Emmons
Isolation
Scalp lesion
Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation