Rhizopus oryzae Went et Prinsen Geerligs (ATCC® 11886)

Product Format: freeze-dried

Deposited As Rhizopus oryzae Went et Prinsen Geerligs, teleomorph
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety  classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Type Strain no
Preceptrol® no
Medium ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24.0°C
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TGCGGAAGGATCATTAATTATGTTAAAGCGCCTTACCTCTTAGGGTTTCCTCTGGGGTAAGTGATTGCTTCTACACTGTGAAAATTTGGCTGAGAGACTCAGACTGGTCATGGGTAGACCTATCTGGGGTTTGATCGATGCCACTCCTGGTTTCAGGAGCACCCTTCATAATAAACCTAGAAATTCAGTATTATAAAGTTTAATAAAAAACAACTTTTAACAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCAAAGTGCGATAACTAGTGTGAATTGCATATTCAGTGAATCATCGAGTCTTTGAACGCAGCTTGCACTCTATGGTTTTTCTATAGAGTACGCCTGCTTCAGTATCATCACAAACCCACACATAACATTTGTTTATGTGGTAATGGGTCGCATCGCTGTTTTATTACAGTGAGCACCTAAAATGTGTGTGATTTTCTGTCTGGCTTGCTAGGCAGGAATATTACGCTGGTCTCAGGATCTTTTTCTTTGGTTCGCCCAGGAAGTAAAGTACAAGAGTATAATCCAGCAACTTTCAAACTATGATCTGAAGTCAGGTGGG

Name of Depositor CDC
Isolation
Clinical meningitis
Cross References

Nucleotide (GenBank) : AF117929 Rhizopus oryzae ATCC 11886 5.8S ribosomal RNA gene, partial