Penicillium funiculosum Thom, anamorph (ATCC® 11797)

Strain Designations: BPI 66 [CBS 235.94, NRRL 3647, NRRL A-1616, NRRL A-622, QM 474]  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
Strain Designations BPI 66 [CBS 235.94, NRRL 3647, NRRL A-1616, NRRL A-622, QM 474]
Application
Fungus resistance testing
Fungus resistance testing airborne equipment
Fungus resistance testing automotive components
Fungus resistance testing paint
Fungus resistance testing polymers
Produces acid phosphatase
Produces dextranase
Produces acid phosphatase with phosphodiesterase and phosphomonoesterase activity
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Type Strain no
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GAGGTCACCGTGGTAAAACATGGTGGTGACCAACCCCCGCAGGTCCTTCCCGAGCGAGTGACAGAGCCCCATACGCTCGAGGACCAGACGGACGTCGCCGCTGCCTTTCGGGCAGGTCCCCGGGGGGACCACACCCAACACACAAGCCGTGCTTGAGGGCAGAAATGACGCTCGGACAGGCATGCCCCCCGGAATGCCAGGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTTTTGACAATTTTCACAGTACTCAGACAGCCCATCTTCATCAGGGTTCACAGAGCGCTTCGGCGGGCGCGGGCCCGGAGACGTGCGTCCCCCGGCGACCAGGTGGCCCCGGTGGGCCCGCCAAAGCAACAGGTGTATAGAGACAAGGGTGGGAGGTTGGGCCGCGAGGGCCCGCACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTAAATGACCAAGTTTGACCAACTTTCCGGCTCTGAGCGGTCGTTGC

Name of Depositor PB Marsh
Isolation
Mercury-treated fabric, Maryland
References

Yoshida H, et al. A novel acid phosphatase excreted by Penicillium funiculosum that hydrolyzes both phosphodiesters and phosphomonoesters with aryl leaving groups. J. Biochem. 105: 794-798, 1989. PubMed: 2753875

ASTM International Standard Practice for Determining Resistance of Synthetic Polymeric Materials to Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method G 0021-96 (Reapproved 2002).

RTCA Environmental conditions and test procedures for airborne equipment -- Fungus resistance. Washington, DC:RTCA;RTCA DO-160C.

U.S. Department of Defense Environmental test methods and engineering guidelines. Washington, DC:US Department of Defense;Military Standard MIL-STD-810F, 2000

Walker GJ, Pulkownik A. Action of alpha-1,6,-glucan glucohydrolase on oligosaccharides derived from dextran. Carbohydr. Res. 36: 53-66, 1974. PubMed: 4369744

Walker GJ. Some properties of a dextranglucosidase isolated from oral streptococci and its use in studies on dextran synthesis. J. Dent. Res. 51: 409-414, 1972. PubMed: 4501480

Standard Specification for Cellulosic Fiber Loose-Fill Thermal Insulation. West Conshohocken, PA:ASTM International;ASTM Standard Test Method C 0739-05be1.

Standard Specification for Self-Supported Spray Applied Cellulosic Thermal Insulation. West Conshohocken, PA:ASTM International;ASTM Standard Test Method C 1149-06e1.

Standard Test Method for Determining Fungi Resistance of Insulation Materials and Facings. West Conshohocken, PA:ASTM International;ASTM Standard Test Method C 1338-00.

Standard Test Method for Determining the Resistance of Paint Films and Related Coating to Fungal Defacement by accelerated Four-Week Agar Plate Assay. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 5590-00 (Reapproved 2005).

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
Basic Documentation