Trametes versicolor (Linnaeus : Fries) Lloyd, teleomorph (ATCC® 200801)

Strain Designations: 13-2336  /  Product Format: frozen

Deposited As Trametes versicolor (Linnaeus : Fries) Pilat, teleomorph
Strain Designations 13-2336
Application
degrades olive-mill wastewater
degrades vinasse
produces abscisic acid
produces gibberellic acid GA3, gibberellin A3
produces indoleacetic acid
produces single-cell protein SCP
produces zeatin
decolorizes: crystal violet
produces single-cell protein from vinasse
decolorization, phenol removal, and production of single-cell protein from olive mill wastes
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Medium ATCC® Medium 323: Malt agar medium
Growth Conditions
Temperature: 30.0°C
Sequenced Data
       18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

ACGAGTTTTGAAACGAGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCTCTGCTCATCCACTCTACCCCTGTGCACTTACTGTAGGTTGGCGTGGGCTCCTTAACGGGAGCATTCTGCCGGCCTATGTATACTACAAACACTTTAAAGTATCAGAATGTAAACGCGTCTAACGCATCTATAATACAACTTTTAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACTTATAAATCCTTGTGATCTATAAGCTTGGACTTGGAGGCTTGCTGGCCCTCGTTGGTCGGCTCCTCTTGAATGCATTAGCTCGATTCCGTACGGATCGGCTCTCAGTGTGATAATTGTCTACGCTGTGACCGTGAAGTGTTTTGGCGAGCTTCTAACCGTCCATTAGGACAACTTTTTAACATCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATC

Name of Depositor O Yesilada
Isolation
Cupressus sp., Adana, Turkey
Cross References

Nucleotide (GenBank) : GU256761 ITS including 5.8S rRNA gene

References

Yesilada O. Decolourization of crystal violet by fungi. World J. Microbiol. Biotechnol. 11: 601-602, 1995.

Fiskin K, Yesilada O. The use of white rot fungi for evaluation and degradation of vinasse. Turk. J. Biol. 19: 181-189, 1995.

Fiskin K, Yesilada O. Degradation of olive mill waste by Coriolus versicolor. Turk. J. Biol. 20: 73-79, 1996.

Yesilada O, et al. Biodegradation of olive oil mill wastewater by Coriolus versicolor and Funalia trogii: effects of agitation, initial COD concentration, inoculum size and immobilization. World J. Microbiol. Biotechnol. 14: 37-42, 1998.

Yurekli F, et al. Plant growth hormone production from olive oil mill and alcohol factory wastewaters by white rot fungi. World J. Microbiol. Biotechnol. 15: 503-505, 1999.