Geomyces pannorum (Link) Sigler et Carmichael var. pannorum, anamorph (ATCC® 11501)

Strain Designations: IMI 23281 [CBS 112.35, CBS 378.76, IFO 31778, LSHB Ag23, NCTC 4074]  /  Product Format: frozen

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Deposited As Sporotrichum carnis Brooks et Hansford, anamorph
Strain Designations IMI 23281 [CBS 112.35, CBS 378.76, IFO 31778, LSHB Ag23, NCTC 4074]
Biosafety Level 1
Product Format frozen
Type Strain yes (type strain of Sporotrichum carnis)
Growth Conditions
Temperature: 24.0°C
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GCGGAAGGATCATTACAGTAGTCACCCGGGTTGCCGCAAGGCCTCTCGGGTAACCTACCACCCTTTGTTTATTACACTTTGTTGCTTTGGCAGGCCTGCCTTCGGGCTGCTGGCTCCGGCCGGCGAGCGCTTGCCAGAGGATCTAAACTCTGTTTGTCTATACTGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACAACCCTCAAGCTCTGCTTGGTGTTGGGCCCCGCCGCCCCGGCGGGCCCTAAAGTCAGTGGCGGTGCCATCCGGCTCCGAGCGTAGTAATTCTTCTCGCTCTGGAGGTCCGGTTGTGTGCTTGCCATCAACCCCCAATTTTTTTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATC

Name of Depositor HA Dade
Isolation
Refrigerated meat, England
Cross References

Nucleotide (GenBank) : FJ545236 ITS including 5.8S rRNA gene

References

Brooks FT, Hansford CG. Mould growth upon cold-store meat. Trans. Br. Mycol. Soc. 8: 113-142, 1923.

type strain of Sporotrichum carnis

type strain of Sporotrichum carnis

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation