Ustilago maydis (DeCandolle) Corda, teleomorph (ATCC® MYA-4924)

Strain Designations: FGSC 9021 [UM521, DSMZ 14603]  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Ustilago maydis
Strain Designations FGSC 9021 [UM521, DSMZ 14603]
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Preceptrol® no
Genome Sequenced Strain

Yes

Mating Type Mating type: a1b1
Comments Genome sequencing strain (Broad Institute, USA)
Morphology Colonies on YM agar at 25°C after 5 days are dimorphic with center flat, finely pruinose, locally smooth and shiny. Later zonate toward margins, radially fibrillar with outermost margin fringed. Yeast cells are fusiform variable in size and have polar budding.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TTTTTTTTCTGAGGTGTGGCTCGCACCTGTCCAACTAAACCTGAGCTACCTTTTTTATATAACACGGTTGCATCGGTCGGTCTGTCGAAACCAGTAGCGCTCATAGCGAGCAGCGTCTGGGGAAAGACGGGTCGGCGCTTCTTACCAACACTTTTGAACACTAGGATTGGAAGGACAAAAATCATTTTTTTGATGATGGAAGCGACTGGTAATGCGGTCGTCTAAATTGAAAAAACAACTTTTGGCAACGGATCTCTTGGTTCTCCCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCGGCAGATTTAATCTGGGGAGCATGCCTGTTTGAGGGCCGCGAATTGTTTCGAACGACAGCTTTTTTTTCTTGTTGAGAAAGAGCTGGCGGATCGGTAGTGAGGGTCTCTGCCATTTACCGTGGCTCCCTCGAAATGCATTAGCGCATCCATTGGAAGGCGGAAAGACGGACGAAAGCTCGAGTTTTTTTGCCCTCGCTTCCCTGCCGGGTTTTGATAATGTCAGGACTTCGGAGGCGAAGAGAGGGCGGGAGCTGGACGCAACGACTTTTCTGCTGTTTGGCGTGCTTCTGAACCCCGCCCATGCCTCTGCTTTAACCACAGAGG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAGAGCCCAAGATTGAAAGCTGGCGTCTTCGGCGTCCGCATTGTAATCTCAAGAAGTGTTTTCCGCTTCGGACCATGCCTAAGTCCCTTGGAAAAGGGCATCATAGAGGGTGATAATCCCGTACATGGCATGGAGCGCCCGTAGCTTTGTGATACGCTTTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATGCCATCTAAGGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGCCAAAAGGGAAGGGTAGGAGGTCAGAGATGCGTCTTGGGATTCAGCCTTGCTTTTGCCTGGTGTTTTTCCCAAGCTGCAGGCCAACGTCGGTTTTGGGCACTGGAGAAGGGTAGGAGGAACGTGGCACCTCTCGGGGTGTGTTATAGCCTCCTACTGGATACAGCGACCGAGACCGAGGAACGCAGCGTACTCGTAAGAGCGGGCCTTTTGGCACCTTTACGCTTAGGGCGTTGGCATAATGGCCCTCTACCAC

Morphology Colonies on YM agar at 25°C after 5 days are dimorphic with center flat, finely pruinose, locally smooth and shiny. Later zonate toward margins, radially fibrillar with outermost margin fringed. Yeast cells are fusiform variable in size and have polar budding.
Name of Depositor FGSC
Chain of Custody ATCC <-- FGSC
Isolation Zea mays, United Kingdom.
Cross References

Complete Genome (GenBank) : AACP00000000 Ustilago maydis 521, whole genome shotgun sequencing project

References

Kamper J et al., Insights from the genome of the biotrophic fungal plant pathogen Ustilago maydis. Nature 444: 97-101, 2006. PubMed: 17080091

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
Basic Documentation