Ustilago maydis (DeCandolle) Corda, teleomorph (ATCC® MYA-4924)

Strain Designations: FGSC 9021 [UM521, DSMZ 14603]  /  Product Format: frozen

Deposited As Ustilago maydis
Strain Designations FGSC 9021 [UM521, DSMZ 14603]
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Preceptrol® no
Genome Sequenced Strain

Yes

Mating Type Mating type: a1b1
Comments Genome sequencing strain (Broad Institute, USA)
Morphology Colonies on YM agar at 25°C after 5 days are dimorphic with center flat, finely pruinose, locally smooth and shiny. Later zonate toward margins, radially fibrillar with outermost margin fringed. Yeast cells are fusiform variable in size and have polar budding.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TTTTTTTTCTGAGGTGTGGCTCGCACCTGTCCAACTAAACCTGAGCTACCTTTTTTATATAACACGGTTGCATCGGTCGGTCTGTCGAAACCAGTAGCGCTCATAGCGAGCAGCGTCTGGGGAAAGACGGGTCGGCGCTTCTTACCAACACTTTTGAACACTAGGATTGGAAGGACAAAAATCATTTTTTTGATGATGGAAGCGACTGGTAATGCGGTCGTCTAAATTGAAAAAACAACTTTTGGCAACGGATCTCTTGGTTCTCCCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCGGCAGATTTAATCTGGGGAGCATGCCTGTTTGAGGGCCGCGAATTGTTTCGAACGACAGCTTTTTTTTCTTGTTGAGAAAGAGCTGGCGGATCGGTAGTGAGGGTCTCTGCCATTTACCGTGGCTCCCTCGAAATGCATTAGCGCATCCATTGGAAGGCGGAAAGACGGACGAAAGCTCGAGTTTTTTTGCCCTCGCTTCCCTGCCGGGTTTTGATAATGTCAGGACTTCGGAGGCGAAGAGAGGGCGGGAGCTGGACGCAACGACTTTTCTGCTGTTTGGCGTGCTTCTGAACCCCGCCCATGCCTCTGCTTTAACCACAGAGG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAGAGCCCAAGATTGAAAGCTGGCGTCTTCGGCGTCCGCATTGTAATCTCAAGAAGTGTTTTCCGCTTCGGACCATGCCTAAGTCCCTTGGAAAAGGGCATCATAGAGGGTGATAATCCCGTACATGGCATGGAGCGCCCGTAGCTTTGTGATACGCTTTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATGCCATCTAAGGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGCCAAAAGGGAAGGGTAGGAGGTCAGAGATGCGTCTTGGGATTCAGCCTTGCTTTTGCCTGGTGTTTTTCCCAAGCTGCAGGCCAACGTCGGTTTTGGGCACTGGAGAAGGGTAGGAGGAACGTGGCACCTCTCGGGGTGTGTTATAGCCTCCTACTGGATACAGCGACCGAGACCGAGGAACGCAGCGTACTCGTAAGAGCGGGCCTTTTGGCACCTTTACGCTTAGGGCGTTGGCATAATGGCCCTCTACCAC

Morphology Colonies on YM agar at 25°C after 5 days are dimorphic with center flat, finely pruinose, locally smooth and shiny. Later zonate toward margins, radially fibrillar with outermost margin fringed. Yeast cells are fusiform variable in size and have polar budding.
Name of Depositor FGSC
Chain of Custody ATCC <-- FGSC
Isolation Zea mays, United Kingdom.
Cross References

Complete Genome (GenBank) : AACP00000000 Ustilago maydis 521, whole genome shotgun sequencing project

Nucleotide (GenBank) : KF278464 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KF278480 D1/D2 region of 28S rRNA gene

References

Kamper J et al., Insights from the genome of the biotrophic fungal plant pathogen Ustilago maydis. Nature 444: 97-101, 2006. PubMed: 17080091